Transcript

sp100.3-201

ID
ZDB-TSCRIPT-141209-293
Name
sp100.3-201
Previous Names
  • dkey-68o6.4-001
  • sp100.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049908 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049908|OTTDARG00000035113|ZDB-GENE-130530-997 si:dkey-68o6.4|OTTDARP00000039164 DKEY-68O6.4-001 LG_ BX569789.4 Danio rerio protein_coding NOVEL, 2620 bp
ATTCGCTTTCGTTTTATCAGTGAGCCTACGCGTCCCGTTG
TGTGGAAGCTTTGTTTAATTCAGGCGGGAGATTTGGAAAC
AACAACCTATTCTGCACAGCTCGTGTCAAGCCAAAGATAC
ACAACTCCATACAGCTTATTGACAGATCAGTTTATGGAAT
TCAACGGGCAGATGGACTTTCTTACTGATGAGCAGTTGCT
GTCTGTCTTCCACCTCAAGAAGACGGAAATTTCGTGCATA
GAACAACCGCTCATCTTCCTCACACAACTGAGAGACCACA
ACCTGTTGCCGGAGACGCGTTTCAAGAAGGTGAAAGGGAT
GCGCACTCGAGAGCAGAGGCAGCAAGGAGTCTATGATGTT
CTGGAGTGGCTGGAGAGAGAGAGATCTCAGGACATTCGGC
GTTTCTGGCGATGTGTGTTTGAAGATCATATCGTGCAGAA
GTACCCCACGCTACACCTGCTCAGGAAAAGCCTGCCAGAA
ACCGTAACCAAATTCTCTGAGGAACGTATAGGCATTGAGA
CACTGACAGAAAATAGTGGACAAAAGGAGAAGAACGGGAC
ATACAACAGAAAGAGAAATGACAGAAGTGATGATCCGGGT
TCTTCAGCCAAGAAACCCTCATTCTCACCTCATGAGAAAG
GAAGCAAAGAGAGGATTTGGATGCTTTCTAGATATAAAAC
TCAGCTGCCTGTAAAGTGTGGGGATAAAGAGGGCATTCTC
TATCGAGACAAACTGGCCAAGGGAGAGAAGTGTATCAGAG
AAGGGGCTCAGGGACGCTGGTTCTCCCCAAGTGAATTTGA
GAAGTTTGCAGGGAAGGAAAGTAGCAGAAACTGGAAAGCC
AGCATCCGCTGTGATGGCACACCACTTAAAAAACTCATTG
AGGAGAATCATCTTCAGTGTCCACCGATGAAGAACAGAGA
TAGAACATCTGTCCGAAAAAGCAAGAAAAACATTTCTATT
AGCTCATCTGAGAGCTCCAGTACAGATTCAGAAACCAGCG
CCAGTTCAGAAGAGGAAAGTGAGGCGGAAGACGTCCAAAA
GCAGAGCAAGAGAGCAGGACTAAGATCACAGTTTAGAAGT
GGAGTTGATGATTATGGGGAGGAGGAAGATGAGATGGTAG
ATCTGACTGTTTTTCAAGCACCATCTTTACCAGTCTCCTG
TGTCTCACTCATTGGGACTCTGTTCAAAGACAGATTTGCC
ACAGGGAGGTGTGGGAAGAGTATACGGACCAAGCAACACT
GGTTTACTCCGGAGGAATTTGTAAAGGAGGAACCAACTCT
CTCTGATGGACTCTGGAAAAGAGATATACTGTGCCATGGA
AAAACTCTCAACTTTTTATGCGAGAAAAAGATCCTGGACA
TCCATCCGAAAAACTGTACATGTGTGAAGTGCAGCACTAA
TCCAGATGATCTGATGGACCAGAACAACGATGATGAGTGT
AATGTGTGTCACTCTGAGGGGAATCTGGTGTGTTGTGATA
AATGTCCACGAGCTTTTCATCCAGACTGTCACCTACCTGC
TGTAAATGAAGAAGACTCGGCCTGGCAGTGGATTTGTACC
TTTTGCATGTTAAGAACCCGTCAACGAGGGTGTGCCTCCA
GAAACATGACTGAACAAGAAGCTTTTGATGTTCCAATATC
TCAATGCAGACTGCAGTGCCACTACCTGCTGTTATGTATG
TACAATGAAGATATCCAGAAGGTGTTTGTAAAGGATCCAC
GCCCAAATGTGAGAAGATACTCTGAGTTCATATCCGATCC
AATGTGGCTGAACAGAATAAAGCAGAAGTTGAAAGATAAC
ATGTATCAGAAGTTTGGAGAGTTTGCCTCTGACTTTCAGC
TCATTTTCAGCAACTGCAGGAAATTTAATCGGGATAACAA
ATTTGGCCAGTTGGGTGCCAAACTGAAAGAAATCTTTGAG
GATGAGATCCAGAAAATCTTCTTTATCCAATAAGGGTTCT
CTTTTTCTTTTGTCTTTCAAAGTTGATGGAGAAATCTAAG
CAGCTTTGAATATTATAATGTAAATGAGATGTATTGCATT
TCTTATCCCACTGCCCTAGGATGAATACTTTGGTTAATAT
TCTCGCTGCACACCTTTTTTATAATTCAATTTTTCTATGC
AGTCATATATTATTTACAACATAGGTTACAGATGGTCATA
TATTATGTCTGTATTATCAGCCTTTTGTCCTCCTTATAGA
TTCTAATTACTGTCTACTGACTTTAAGGTGAAGGGTGTCA
TTTTTATAAATGCAAAAAGTATTCTTGCACTTTTTCCTCA
TACGTTAAGCATTGAATAGGTTATTTGTAAAATGAATTCC
ATGATTGACCTAAAAAACCTATATTTTTATTGACTTTTGT
TATTAATTATTTTACTTGTTTTTAGTCTTCTGTTCTGTTG
TTTTGTTTTGTTTTGATGCTTTCATGTACAAAAAAATGAG
AATAATTTTGGCTGAGGATCGTAAACATTGTAAACAATCT
GGAATTTGTTTCCAATTTTGGTGTTGGGTAAATTTACGTT
AGCTTTTATGTTAGGCTTTTTTTTTAATTGTAAGTAAAAC
AGACACTTTAATATGATGTTTATATTTAATATAATGTACT
TTAATAAAAGTAAGACCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations