ZFIN ID: ZDB-TSCRIPT-141209-293
Transcript Name: sp100.3-201
Previous Names: dkey-68o6.4-001, sp100.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049908 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049908|OTTDARG00000035113|ZDB-GENE-130530-997 si:dkey-68o6.4|OTTDARP00000039164 DKEY-68O6.4-001 LG_ BX569789.4 Danio rerio protein_coding NOVEL, 2620 bp
ATTCGCTTTCGTTTTATCAGTGAGCCTACGCGTCCCGTTG
TGTGGAAGCTTTGTTTAATTCAGGCGGGAGATTTGGAAAC
AACAACCTATTCTGCACAGCTCGTGTCAAGCCAAAGATAC
ACAACTCCATACAGCTTATTGACAGATCAGTTTATGGAAT
TCAACGGGCAGATGGACTTTCTTACTGATGAGCAGTTGCT
GTCTGTCTTCCACCTCAAGAAGACGGAAATTTCGTGCATA
GAACAACCGCTCATCTTCCTCACACAACTGAGAGACCACA
ACCTGTTGCCGGAGACGCGTTTCAAGAAGGTGAAAGGGAT
GCGCACTCGAGAGCAGAGGCAGCAAGGAGTCTATGATGTT
CTGGAGTGGCTGGAGAGAGAGAGATCTCAGGACATTCGGC
GTTTCTGGCGATGTGTGTTTGAAGATCATATCGTGCAGAA
GTACCCCACGCTACACCTGCTCAGGAAAAGCCTGCCAGAA
ACCGTAACCAAATTCTCTGAGGAACGTATAGGCATTGAGA
CACTGACAGAAAATAGTGGACAAAAGGAGAAGAACGGGAC
ATACAACAGAAAGAGAAATGACAGAAGTGATGATCCGGGT
TCTTCAGCCAAGAAACCCTCATTCTCACCTCATGAGAAAG
GAAGCAAAGAGAGGATTTGGATGCTTTCTAGATATAAAAC
TCAGCTGCCTGTAAAGTGTGGGGATAAAGAGGGCATTCTC
TATCGAGACAAACTGGCCAAGGGAGAGAAGTGTATCAGAG
AAGGGGCTCAGGGACGCTGGTTCTCCCCAAGTGAATTTGA
GAAGTTTGCAGGGAAGGAAAGTAGCAGAAACTGGAAAGCC
AGCATCCGCTGTGATGGCACACCACTTAAAAAACTCATTG
AGGAGAATCATCTTCAGTGTCCACCGATGAAGAACAGAGA
TAGAACATCTGTCCGAAAAAGCAAGAAAAACATTTCTATT
AGCTCATCTGAGAGCTCCAGTACAGATTCAGAAACCAGCG
CCAGTTCAGAAGAGGAAAGTGAGGCGGAAGACGTCCAAAA
GCAGAGCAAGAGAGCAGGACTAAGATCACAGTTTAGAAGT
GGAGTTGATGATTATGGGGAGGAGGAAGATGAGATGGTAG
ATCTGACTGTTTTTCAAGCACCATCTTTACCAGTCTCCTG
TGTCTCACTCATTGGGACTCTGTTCAAAGACAGATTTGCC
ACAGGGAGGTGTGGGAAGAGTATACGGACCAAGCAACACT
GGTTTACTCCGGAGGAATTTGTAAAGGAGGAACCAACTCT
CTCTGATGGACTCTGGAAAAGAGATATACTGTGCCATGGA
AAAACTCTCAACTTTTTATGCGAGAAAAAGATCCTGGACA
TCCATCCGAAAAACTGTACATGTGTGAAGTGCAGCACTAA
TCCAGATGATCTGATGGACCAGAACAACGATGATGAGTGT
AATGTGTGTCACTCTGAGGGGAATCTGGTGTGTTGTGATA
AATGTCCACGAGCTTTTCATCCAGACTGTCACCTACCTGC
TGTAAATGAAGAAGACTCGGCCTGGCAGTGGATTTGTACC
TTTTGCATGTTAAGAACCCGTCAACGAGGGTGTGCCTCCA
GAAACATGACTGAACAAGAAGCTTTTGATGTTCCAATATC
TCAATGCAGACTGCAGTGCCACTACCTGCTGTTATGTATG
TACAATGAAGATATCCAGAAGGTGTTTGTAAAGGATCCAC
GCCCAAATGTGAGAAGATACTCTGAGTTCATATCCGATCC
AATGTGGCTGAACAGAATAAAGCAGAAGTTGAAAGATAAC
ATGTATCAGAAGTTTGGAGAGTTTGCCTCTGACTTTCAGC
TCATTTTCAGCAACTGCAGGAAATTTAATCGGGATAACAA
ATTTGGCCAGTTGGGTGCCAAACTGAAAGAAATCTTTGAG
GATGAGATCCAGAAAATCTTCTTTATCCAATAAGGGTTCT
CTTTTTCTTTTGTCTTTCAAAGTTGATGGAGAAATCTAAG
CAGCTTTGAATATTATAATGTAAATGAGATGTATTGCATT
TCTTATCCCACTGCCCTAGGATGAATACTTTGGTTAATAT
TCTCGCTGCACACCTTTTTTATAATTCAATTTTTCTATGC
AGTCATATATTATTTACAACATAGGTTACAGATGGTCATA
TATTATGTCTGTATTATCAGCCTTTTGTCCTCCTTATAGA
TTCTAATTACTGTCTACTGACTTTAAGGTGAAGGGTGTCA
TTTTTATAAATGCAAAAAGTATTCTTGCACTTTTTCCTCA
TACGTTAAGCATTGAATAGGTTATTTGTAAAATGAATTCC
ATGATTGACCTAAAAAACCTATATTTTTATTGACTTTTGT
TATTAATTATTTTACTTGTTTTTAGTCTTCTGTTCTGTTG
TTTTGTTTTGTTTTGATGCTTTCATGTACAAAAAAATGAG
AATAATTTTGGCTGAGGATCGTAAACATTGTAAACAATCT
GGAATTTGTTTCCAATTTTGGTGTTGGGTAAATTTACGTT
AGCTTTTATGTTAGGCTTTTTTTTTAATTGTAAGTAAAAC
AGACACTTTAATATGATGTTTATATTTAATATAATGTACT
TTAATAAAAGTAAGACCATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sp100.3-201 Contained in:
[BAC] DKEY-68O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049908 (1),  Ensembl_Trans:ENSDART00000123017 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT064549 (1) 746 nt
CITATIONS (2)