Transcript

fam161a-201

ID
ZDB-TSCRIPT-141209-2795
Name
fam161a-201
Previous Names
  • fam161a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052568 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052568|OTTDARG00000036901|ZDB-GENE-110310-1 fam161a|OTTDARP00000041323 fam161a-001 LG_ CU693443.4 Danio rerio protein_coding KNOWN, 2775 bp
TATGAAGAAATCGCACCGTACAAATGTCTTGGTGACATCC
TGTCTGAAGACCCCGGTGGACCCGCAAACCAAAGTGCCGT
TAGCTCAGTACGAGCGGGAGCGGACACTGCCGCGCGCGGC
CGCGATGACGGACAACAGGCACTATGAAAAAGAGATGGAG
TATGACTCTGGATCTGATTTGGTGGCTGATGACCCTCCTG
CCAAAGACAACAATGCTCTGCTTATCAAAGACTACCGTGT
GACGGGCGATCGCATCGACCTCAGGGAGTTTTACTTCTCA
AACCAGGAGTACTACCGTAAACTAGAACAGCTGAAAACAG
CTCACCTCCAAACAATGGCTGAACTCGAACTAATGTATCG
CAAGAAACTCGACCTTAAAGGAGCGACTGCTGTGGACAAC
ACTGAGCGGGCCAATCTATCCCCACAAGGAAGTCCAGTGA
TAACCAGCGGTCTGAAAAAAGCCCAGTCTGCTTTAGAGTT
ACGACGGACTTCAGATCCATCTGATTTGTCTGACGAAGAA
GGCCAAGGAGATCGCAACACGGAGAAAGGCCTTCTTATCT
CACCGAAAGAACACATTAAAAACATGTGGCAGGACTTTAG
CGTTAATAAGCTTTCTCCACCTCACCGGCACCCCATGTCC
TCCTCAGTGCATAGTCTACCAGCAGACTGCCAGGGTATTA
GCAAACCCAAAGAAAGGATTAGAAGTCAGCGGGCGAAAAA
ACACAAGCATCATGAGGATTGGCATCCGAGAGTGACAGTC
CCGAAGCCTTTCCAGATGACCGTCCGAGAGGCAGAATGGC
GCAAGAAGGGTGTAAAATCGCGATCTGAGATCGAGCAAGA
GAACGCGGATCTCCGACGGCAGCTGGAAGAGCTCAGCGAG
TGCCAGAAGAAGTTTCGTGCCAGTCCCATTCCTGCCCATG
TGCGCCTCCCGTTGTATGAAGATCTGCAGGAGCGTAATGA
AGAGCGAAGAAGACTCCATCTGGAGTTTGAACAGCAGCGT
CTTCACATCTCTCAGAAACCCTTCCGCTTCCTGGAGCGCG
AACGGTTGAAGAAAGAACAGAAGGACGCCAAGCTACGCGA
GCAAACACTTCAGCGTAACAAAGAGGAAGAGGAGAGGAGG
AAGTGCCCGTTTAAAGCCAAACCTGTCCCAAAGGCGGTGA
AGGAAGCCACGTTGGGCGAGCGACAGAAAGAGGAGGAACT
CTACAGGGCAATTAAAATGCAGATGCGGGCGAGAGAGATG
CTACACACTGCATCCATGCCTCCTAGCATGCTTGCGCGTC
AGCTCAGCGAAAAACAAACTCAAAAGATCATCGTTAAAGA
TGCCGAAGAGACACACCAGCCCAAAATCAACGCTGAAGTG
CCAGATTTCGATGCCAGCTACAGGAGGTTTCGGAAGCAGC
TGGCAAAACGTAAAGAGGTGATGCCTGTCACATCATGCGA
ACCATTCCAACTGCGCACAGCTAACATCACATCGCACAAA
GAACGCATCATGGCGGAAATCCAAGCAGAAATACAGAGCC
CAAAACCATCGCGCTGGCCATTTGTGAACACGCCTGTCCT
TTCGCCCAGGACGCCTTCATCTTCTCTTTGCTCCTCGCTT
TCCGGAAGCCAGGAATGTTTGTCTGCTAAGATTACTGATG
CTGCTAAGAAACGGCAAGAAGCTGTGAGAAAAGTTCTCGA
GCACAGAAAGAAAGCAGAAGAAGAGGAGGAGAAATGGAGG
GAGAAGCAAAAACAGAGAGAGAAGAGGCTGCAGAAGCTGG
TCACAAAGCGAGCTCAGGCCATCGATCCACATGTAACCCT
GGCTCAGACATCCCCTAACAAGCTAAAAGAGTTCAGGAAA
CAAGATCTCCAGAGACAGAAAGAGTATCAGGACGAGATGA
GAGAAATCCAGAAAAGAGTAAAGGGAAGGCCTTTGTTACT
GGAGCAAGTAGCACAGATGAATGCTAAGAGAGCTGCTGAA
AAGCTCTACTCTTCCACTTTGCATGGATGTGGTCTGAGTG
AATCCTTTATCAGCAGTAAAGCTCCAAAGGGCTTAGAAAA
CAGACTGACTCCAAGCCCCGCCCACTCCGACAGCATGAGT
CCACCCACATACAGAAACAGACTTGAGGATGATGAGGATC
TTCCGGACATGCAGGATTCTCTTCTCGATGACTATCCGGA
TGATTATGAGGAGTATGACCATGACATGGAGACAGAACTT
GTCGATGGAGATGAGGAGCGGAAACACAGCGAACATCATG
ACTACGGGGATGAGGAAAAGGATGATGATGATGATGATGA
TGATGATGAGATGCAATTTGATGATGATGACTGTCAGGGG
GATGATGACATCATCAGGAGGCACAGTCAGAGCAGCAAGG
GTAGCGACAGAAGTGATCACAGCAACAGGAGTAGAACAGG
TAGTGTTAATTAGTTAACTGCAGCGGTGTAAAGTAACAAA
TTACAAATACTCAGACTACTGTAATTGAGTAGTTTTTCCT
CAGGAATTGTAATTTACTAAGTAGTTTTTAAAATGTGTAC
TTTCACTTTCCCTTGAGTACATGTGTAGTGCAGTATCGGT
ACTTTTACTCCACTACTTTCCCTCAACCTGCAGTCACTAC
TTTATTTTTTCCTGTCTATGGGGATTAGAAAAATCAGTCC
TGTGATTCCTGTCACACATAGAAAGTAAATCATAATGAAC
TACCTCAAGACATGGGCGATTTATAATCACAGCAAACTGT
TTGGAAGCATTAAAAGTGTCCAAGAAGATATTCAAAACCT
TTACAAGTATTGACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations