Transcript

timm10-201

ID
ZDB-TSCRIPT-141209-279
Name
timm10-201
Previous Names
  • timm10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048537 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048537|OTTDARG00000034323|ZDB-GENE-040718-427 timm10|OTTDARP00000038068 timm10-001 LG_ CT583626.15 Danio rerio protein_coding KNOWN, 834 bp
CAATTACAACGCTGGATGGAAAGGAGGATCCACGTGGGTT
GTTTCTCCGGTCAAGCACACAGACACTGAAGGTTAAAGCA
GGCTGTCGAGGCTCTTTGTTGAACGGGATCCGCGCGCAGA
CCGGTGGGTTTTTGTCGAGGGGGAACCGAAAGGACGTTTG
CAGAAATGGACCCGATGAAAGCGCAGCAGCTCGCCGCAGA
GCTGGAGGTGGAGATGATGGCTGACATGTACAACCGGATG
ACCAACGCGTGTCACAGGAAATGTGTTCCCCCTCATTATA
AGGAAGCGGAGCTCTCGAAGGGGGAAGCTGTTTGTCTGGA
CCGCTGTGTGGCCAAATACTTGGACTTGCATGAGAGACTC
GGCCGAAAACTCACAGAGCTCTCGGTTCAGGATGAGGAGG
TGATGAGGAAAGCTGCTGCTGGAACTGGATAATCTTATAT
AAACTCCAAGGGTGGGGGATCAAGTCCTTGGATGATGGGG
TTTATGGGAGAAGTGGGCACAATTTGGACATCCAAACAGG
GAAATCTGACAGGATTGCCCATGGATATATACCTTCTAAA
GTGAATATGAACACATATTGACTTTCTGTTAGATATGCCA
TGTGAGGGGTAAAGCGTTTTGGAGGAGATGATTGGATGTT
TTACCTCAGAAGTTGATGAGTGTTTTGGCTTTAGCAGTTA
TTGACAGGAATAAGATGTCTTGTTGAAGAAATTTGAGAAT
TGATGTCCTTGTGAAATTGTTGGTAACTTTTTATGTTGGC
TCTGGTCATTGTTATTTCTGTCGTTTTACTAAATCTTTCT
TTATTGGTCAACAAAATAAAAATGTTTACCATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations