Transcript

col6a1-201

ID
ZDB-TSCRIPT-141209-2758
Name
col6a1-201
Previous Names
  • col6a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050964 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050964|OTTDARG00000035781|ZDB-GENE-070501-6 col6a1|OTTDARP00000048028 col6a1-001 LG_ CR925698.8 Danio rerio protein_coding KNOWN, 5637 bp
GCTGAAAGGCGTTTCATTCTGCTGCGCGCTCGGAGCGGAC
GCGCTACTGTCCGCCACTGCATCCCACAGACCCTCATTTC
ATAATTCATCTGTATTTATATCACTCATTCTGTATTGTGT
GTTCCCCCCACCGCCACTTTGCACGGTTAACGTGCAGTTA
AATCAGGATCTATGGCGCTTAATGGATATATATTGACCGC
TCTGTGCGCTCTTTGGGCAGGGATCTTCGCTCAGGATGTC
TCCAGATCCTCCTTCAGAGAGTGTCCTGTGGACCTGTTCT
TTGTGCTGGACACGTCTGAAAGTGTGGCTCTCAGAGCCAA
ACCTCCAGAGTTTTACATCAACCAGATTAAGACCTTCACA
AAGCTGTTCATCGATGAGCTCAAAGACCTACGCCAGCCCT
GTGATCGCGATGTGACATGGAACTCGGGAGCGCTGCACTA
CAGTGATGACACAGAGCTGGTCATGGGATTAGTCGACCTC
AACACAAAACGTGCTGACCTTAAAGCTGCCATCGACAGAA
TCAAATACATCGGCAAGGGAACGTACACCGACTGCGCCAT
CAAGGAGGGCATCGCTGAGCTGCTCAGAGCGGGTTCGCAT
TATCATGAGAATAAATACATTGTGGTGGTGACGGATGGTC
ATCCTATAACCGGATATAAGGAACCATGCGGTGGCATTCA
GGAGGCCGCCAATGAGGCTCGACAACATGCCATTAAAGTG
TTTGCTGTGGCCATCTCACCTGACCAGGAGGACACCAGAC
TGTCTGTCATTGCCACAGATATAAACTACAGACAGAACTT
CACCGCTGCAGACAACTCCCGCTCCACACAAATGAGCACT
ATACGCTCCATCATCCACATGATTACAAACGAAACAAAGG
ATGTGTGCTGCTCCTTTGACTGCATCGCTGATGGAGGCCC
TCAAGGACCCCCTGGAGATCCAGGTCAAAGGGGAGAGACC
GGGAGACCAGGCATGCCAGGAGAAAAAGGAGACTTTGGGG
CTCAGGGAAATCCTGGTGATCCCGGTCCAGTCGGTTACCA
AGGAATGAAGGGAGACCAGGGAATAAAAGGTGATAAGGGA
GAGAGAGGTCATAAAGGCTTCAAGGGAGACAAAGGTCATC
ATGGTCTCGATGGCACGGATGGACGTAAGGGCGAGCCGGG
ATTCCCTGGACTTCCAGGCTGTAAAGGGTCACCAGGGCCA
GATGGTTTGCAAGGAGAATCAGGGCCTAAAGGAGACCCCG
GACAATATGGACGCAAAGGAGAACGAGGAGATCCTGGCAG
AGATGGTGAGCCAGGAAGACCTGGAAACTACGGACCATCT
GGGGCCAAGGGAGACAGGGGTCCTCGTGGGGCTAACGGCG
ATAAAGGCGAGAGAGGAGATGATGGACCACCAGGACCAGA
TGGCCCAAGAGGAGAAAGAGGCCAAGGTGGTGAGAAGGGT
GAACAAGGGTCTCGAGGTAACAGAGGTCCCAGAGGCGAGC
CTGGTGAACCCGGGCCAAGGGGTGAGCAAGGACGTGAAGG
ATCATCCGGAGCAAATGGAGAGCCGGGTGAGCAAGGAAGA
GCAGGGCAGCCAGGTTATCGTGGCGATGAGGGTCCTGCTG
GGCCAGAGGGAGATAAAGGGCCCAGAGGAATCAAAGGGGC
TCCAGGAGACAGAGGCCTGATGGGAGAGAGGGGTGAAGAC
GGACCTCCAGGAAACGGGACGGAGGGTTGTGCTGGCTTTC
AGGGTTATCCTGGTCCAAGGGGAGATCCTGGAGCACCTGG
TGGAAAAGGAACCCCAGGACCCAAGGGAGATGATGGAGAG
CCGGGTGACACTGGATTAGATAATGACAGACTTGGACCAC
CTGGGACAAAAGGAGCCAAAGGTCACAGAGGACCTGAAGG
AAAACCTGGACCCCCAGGACCACCCGGACCTCAAGGAGCT
GATGAATGTGAGATTCTGGATATCATCATGAAGATGTGCT
CTTGCTGTGAATGCACATGTGGACCCTTGGATATTGCCTT
TATCGTGGACAGCTCTGAGAGTATTGGAGCTTCTAACTTT
GCCATCTCTAAAGAATTCATCGTGACAATAATGGACAGAC
TCAAGTTAAGACAGTTTGGTGCCAATGAGTCTCGTATTGG
TGTGGTGCAGTACAGTGGTGAAAAATCTCAAGAGGTGGTA
CAGCTTGGTGACCCCAACATCAAGACCCTGACCGACCTAA
AACAAGCTGTGAAAGACTTGCGCTGGCTGGCTGAGGCCAC
ATACACTGGAGAAGCTCTTCAGTACTCGCTAAGAAACATG
CTCAGCAAGCTTATCACGGAGAGGAGTGTGGTCCTTGTTC
TTACTGATGGACGCTCAGACACTATTAGGGATAAAGTGCC
ATTAAACGTGCTGTGCGGCAAAGGATTTAAGGTTGGTGGG
GTTGGAGTGACGGATTACGCAGAGAGGAAACCCAATCCGG
AACAGCTTGATGAGGTTGTGTGTAAAGATGATCCTAGAAA
AGGCTTCTCCTTTGTCCTAAACAACTTTGGCCTACTTCTG
GATGACAACTTCCTGCAAAACCTGACTGAGAAAATCTGTG
AAGATAAGAAGTGTCCCACATATACTTGTCCAATTTCATT
TAATGACAACACCGATGTCCTCATCATGATGGACAGCTCG
GCCAGCGTTGGCGCCAAGAACTTCGAGATGACCAAGGACT
TCTCACGGATGCTAGCTAAGCGCTTTTTGTCAGCAGAAAG
AGGAAATTTCCAGGTTCGAATTGGTGTTGGCCAATACAGC
AACAATGCCAACTTGGAGGCCGAATTTTCCACAAACGCCA
CTCAGGTGGTCGCTCAAATCGCAGACGCCAAGTTCCAGAA
TGCAGGTACACAGGTAACAAACGCTCTCAACTTCGCCATC
GAGCGCTTCAGAGGCGGTAGGACGAGGAAGAAGAAGCTGC
TGGTGTTTTCTGATGGTCGTTCTCAAGGTGTTAACTCCAT
TCAGATTGAGAAAGCCGTGGAGCAGGTGAGCAACGCAGGA
ATTGAGCTGTATGTTCTTGCTGTTGGAAATCAGGTGAATG
AAGCGCATTTACGCACCTTAGTGAGCCGAGGCCGGCCTTA
CGACAACACCTACGCCTACCGCCATCTTTTCAAAGTACCC
GACTACCGCTCATTGGTCACTGGGGTATTTTACCAAACTG
TGTCCCGCAAGATTTCCCTGGAGACGAGAGGGTGATTGGA
TAATGGGAGGGGGTGAGGAATAAAGGGCATGGGTGGCATT
ATAGCACAAGCTTTAATTGTTTTAGGGTTTTTATTTTGTC
TACGTTTTTCATGTGAACGATGTATCTGAACCTGAAAGGT
TTTTCATAGTCATTTTGTAAAAGACAGTAAATGATTGTGT
CAGAATTCTTTAAAACATTAGTATTTTTATGTCACTTATG
TCTTAAAACTTAGGGGATTACTCAAGAGATGTTTCACAGT
TGTTGGAGGGGGTATTAGGGCTTTGACTAGGTATATGGCT
GCATTCGTTTTGCTGTCCATGAAATTTTTCAACACTCAAT
CATTCAACACTCAATCATATGTGTATTATCTAATGTCGAG
AGCACAGAATTTTTTTTTTCTCCAGTGGTGAATAGATAGA
ATCTGTATAATTCAGACTTAAGCCCCTTTCATATAGGCAT
ATCGGTAAATATCCGGAAAATTTCCAGAACAACTTTACCG
TTAAATTCAAAAAAGCACTGTTCACACAGGCAAGGATGTT
CCGGAATTTTTCCGGAAAAGAGCATTCACACATCTATTCC
AAAATACCGGTAAATTCTGACATCATTAACCAGAAATTAT
CTCTAAACAGCTGCGCTTGTATTTGTAAACATTTGACTAC
ATTACAAACTCTTTGGATGGAGAAGCATTGTGAACAACTT
CGATGAAAACATATGAGGGAACACTTTCGCATGTCGAAAT
GTTTATATTATGTGTGTGTGCCGATTCTTGCTGGCTGCTT
CACATGCACACGCGTCAAGCAACTGAAAGAAGCAGAGCCT
GAAGGTAAACAAACAGCGGCTTATCATAAGCATTTTATCA
ATAATTTTGTACACAGTTGGCATTAAGAAGGAACATAGAA
ACGTTGTCTGACTAACATCTAGCAGCTAAATGTGTCTGGA
AAAATATTCAAAGGCTTTTTTTTTTCATAAACAGCGCGAC
AATGTGTCTGAATGTTCTGATTGGTTGGAGTAGACGTCTC
ACGTCAGTGTGTTCTATTAGTGAACATGCTCTTTCCGGCA
ATTTTCCTTCTGCGTTCACACAGTGCAGAATTCCAGCAAA
TTACCAGTAATGCTACAAGTTCTCTTTCTGGAAAATTGCC
AGAACAAAATTACTGGTATTTTCAAAAAAGGCCTGTTCAC
ACATACAGACCTTTCCGAAAAATTGCCGAAATTTCCAAAA
TTTTAATTTTCCAGAAAGGTCTATCTGTGAAATGAGCCTT
AGTATCTTTAAAGTAATAATTCGCCCAAAAATAAAAAATG
TACTCTCTAGTTACGTGACCTTAAGTCCATTTAAACCTTT
TTCTTCGGTTGAAAACAAAAGAATATATTTTGAAGAAAGC
TGAAAACTCATAGCCATTGACATCTATAATAAAAAAAGCA
AATCCTATGGATGTCAATGGTTACAGGTTTCCATCATTTT
TTCAAAGTATATTAATTTGCGTTCAACAGAAGAAATAAAC
TCAAATAGGTTTTAAACAAAAGGAGGGAGAGTAAATGATC
ACAAAATGTTCATTTTTGAAAATGTTCATACCTTTAACGA
CCGTTCATGCTGAGATACATATCTATAAAGATAATCACTG
GGATAATAATATCCATGTCAATGTACTATTAACGGAAATT
GTGATGCCTGCCACTTTGAATGCACACACTTGTTAAAGCA
GGATGGATTGTGATTGGCTGCTTTTATCATTCATAAGCAG
AAAGAAATAGAACTGTATCTTTATCTTTATAGTTATCCTT
TGTATGAATGGTGCTTTAGGCACTTTTAAGGCTCATTCAC
ACCAAGAATGATAACTACTGTTTTACAATAACTATATTTG
TGTCCACATAAACATAAAGAAATGTCATTTTTATCCTTGT
GTTAAGTGCAAACTTCAGTTTTGTCATCTGCTTCTTAAAA
TGCATGAAATTGACAAATAGGATGGGTTCCAACTGAAAGT
GTTTTCAGTGATGTTTTCTATGCTGTTATTATTACAGCTG
TGGTGTCTCTTATTCTTTTATATCTGTTTCTTTATTGTTA
TCACTAAAGTTGCTTTTCTTGGATTGAATGAGCCTTTATA
AATAAAAGTAGTGTAATGCAACATAAACAAATATTGCTAA
GAGGGTTCAAAATCAACATCTATCTTGCCTTTATTTTGGA
CCCTGCTTGCAACAAAATCTGAGCAATTAAAAAAAAAAAA
GTTTTGTTTTTTTCATTAGTTTGTGATACACTTATAGCAT
TGACAGTAAAACTTGAATATAAATTTGGTGCTACCGATGT
AAACACTACACTAGCTCCTTTAGCTACTCAAATGCAGGTT
TCTTCAGAAGTATTCTTTACACCTTAAGCCAAAGAGTTTA
TCGATGGGTTTCTTGTGTCAGAAATGTATTTGAAACTTTG
TAAAGGTATTTGAAATAAAGGACGCTACACCCCACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations