Transcript

si:dkey-68o6.6-201

ID
ZDB-TSCRIPT-141209-2735
Name
si:dkey-68o6.6-201
Previous Names
  • dkey-68o6.6-001
  • si:dkey-68o6.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049910 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049910|OTTDARG00000035115|ZDB-GENE-141212-381 si:dkey-68o6.6|OTTDARP00000039166 DKEY-68O6.6-001 LG_ BX569789.4 Danio rerio protein_coding PUTATIVE, 1192 bp
GAGCGTGCAAAAGGAGGGCAGATTAGATGTGTGTATGCAT
GTGTACGTAACTCTGCTAAAAGAAGATCTAGAAAAATAAA
ACTACAAGTCGAAGACACAGCAAGGACATGGATGAAGAGT
CTGTGACAGACACCGAGTCTGAATCAGCATCTCAATGGGA
TCCAAAGAGTAGCACTGAATCTGAGAGCTGGAGTGAGGGC
AGCAGAGAAAACAGAAGTAAAAAAAGAAAGAAAACAAGAA
AACAAACCTCGTTCACCAAGTTTTCAAGACAATCAATTGA
AAAGAAACGTGAACTTGATGTCACATGTGGGGATAAAGAA
GGCATCCTGAATCTGGAGAAGTATAATAATGACATTCAGG
AGTGTATCTTCAGTGAAGGCCGGTGGTTTACGCCGAGCGG
CTTTGAGAAGTTTGGAGGAAGGGAAAGAAGCAAGAAGTGG
AAAAACAGCATCCGATGTGATGGCCTTCCAATCCAAGAGC
TTTTGGATATGATGCAGACATATGGAGACAGTGCAAGCAC
TGTGCAGAATGAAACTATGACCTCTGAATTATTAAACTCT
TTAAAAGATTTCCCAGAGTCATGGAAAAGCTTGTTTTCCA
AAACTCTAAAAGTACATGTGTGTAGAAATGAAGGGGAAAT
ACTCCGGAAGCAAACAACCCAGACAGCACATACAGACAGT
TCTTCAGATGAGTCTGTATCTGTTGCTGAAAGAGTTAAAA
CGAGCAGGAGAGATTTTGTGATTTCAACTGAAACTGTCAG
CAAAATGGTGGAATCTTCTAGCAATGATGAAGCACATACA
GACAGTTCTTCAGATGAGTCTGTATCTGTTGCTGAAAGAG
TTAAAACGAACAGGAGAGATTTTACGATTTCAACTGAAAA
TGTCAGCAAAATGATCACTCAACAGGTGGAATCTACTCAC
AATGATAAAGGTTTGTATTTCTCATCATTTCCTCTGTATG
CAGTTTTTCCTCTGTTTCCCATTTCTTAAATTCCCAATTT
TTTTGTAGTATTGTGACAGAAGTTGGAGGATATATTTTAA
ATTTCTGCTACTAAATAGAAAAATAATAGTTATAGATAAC
TGTTAACCTACGTAACATCCAATCTTTCAAATATACCATT
AAGTATAGAAAATATAAAATGAAATACAAAAAAAATCTGT
CAGTATTAAATTTTTCGTTTTATACACATGGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations