Transcript

sp100.2-201

ID
ZDB-TSCRIPT-141209-2734
Name
sp100.2-201
Previous Names
  • dkey-68o6.3-001
  • sp100.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049907 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049907|OTTDARG00000035112|ZDB-GENE-141212-296 si:dkey-68o6.3|OTTDARP00000039163 DKEY-68O6.3-001 LG_ BX569789.4 Danio rerio protein_coding NOVEL, 1928 bp
ATGCACTATGTGAAGTATACAAACATATATATATGTAATT
TGGAGGCAAAGACAGTTCTCTACTAGCTGAATTGAATCAA
ACTTTACGTCCTACTTCATTTTGAAACCGGTCATATTCAC
TTTCGATTCATCACTTCCGCGAACTGTCGCAGTATGAGCG
AGATCTTCTCAATTGAAGCGGGAGATTTGGAAACGATAAT
AACTGTCTATTCGGTTCTTGTCAAGCCTAAAATATACAAA
ATCCTCCATTTTGCTTGGTCATTGACAGTGAACTGCCAAA
TTGAGTTGCTAACAGATGAGCAGTTGCTGTCTTTCTTCAA
CCAGAGGAAGAAGGATATTTCGTGCATTGAACAACCAAAC
ATATTCCTGACACAACTGAGAGACCACAACCTGTTGCCGG
AGACGCTTTTCCAGGCAGAAGGTGAATGCGTTGCACACTC
GAGAGCAGAAGCAGAAAGGAGTCTGAGGTTTTGGACTGGC
TGGGGAAAGAGAGATCTCAGGACATTCGTCGTTTCTGGCA
CTGTGTGCATTCTACGCCTGCTCATGGACATCCTGTCAGA
TGCTGGACCTCTAGATGCTGAGATGCTGACAAAAGAGAGT
AAAGGAGCAGTGAACAAAGGGAAGGAAAAGAAAGACACCA
GAAAGAAAAGTAAAGATGGCGTATATAGTGAGGATAGTGA
TGATCCGGGTACTTCTTCTGCTTCCAACGTGACTCCGAAA
AAAAAAGCCAAGAAATCTTCATTCTCATCTCCTGTAAAGA
CAGACAACAATCAGGAGATTTGGATGTTTCCTAAATATAA
GACTGAGCTGCCTGTAAAATGTGGAAACACAGAAGGCACT
CTCCATCGGGATAAACTGGCCAATGGGGAGAAGTGTTTAT
TTGCTCAGGGACGCTGGTTCTCCCCAGGTGAATTTGAGAA
GTTTGCAGGGAAGGAAAGAAGCAAAAACTGGAAAGTCAGC
ATCCGATGCGAAGGCACACCACTTAAAAAACTCATTGAGG
CGAATCTTCTTCAGTGTAAACCGATGCAGAGAAAGCAGGG
GACCTCTGTCCGAAAAAGCAAGAAAGTACAGATTGTGATC
AGTTCATCTGAGGACTCCAGTCCAGACTCAAGACCGTACT
TTTCAGGAGGAGGATCACAGTTCAGAAGTAGAGTTGATGA
TGATGAGGAGGAAGATGAGATGGTAGATCTGACTGTTTTC
CAGGCTCATTCTTTACGAGTCACCTGTGTCTCACTCACTG
GGACTCTGTACAAAAAACGGTTTGCCACAGGGAAGCGTGG
AAAGAGTATACGAACTGAGGAACGCTGGTTTACTCCAGAG
GAATTTGTAAAGGAGGAACCGACTCTCTCTGATGGATTCT
GGAAAAAAGACATACGGTGTCATGGAAAAACTCTCAACTT
TTTATGCGAGAAAAAGATCCTGCAGATTCATTCTGTTCTG
TGTGAATGTGGGAAATGCAGCACTGATCCAAAAGACCTGG
CAGACCAGAACAACGATGATGTGTGTTTTGCGTGTCACTC
TGAGGGAGATCTGGTGTGTTGCGATGAATGTCCACGAGCT
TTTCATGAATACTGTCACCTACCACCTGTACCCAAAGATG
CATCTGGGGAATGGATTTGCACCTTTTGCATGATAAGAAA
AAAGCAACAATTACAGAGCTCCAGCAACACGACTGAACAA
GAAGTGTAACCTGAAGAGACATGCTACTTTATTGTTCATA
GATTTTAATTATTTTAATATGATATTTTTGATATGTTTAT
GTGTATATTATTTGATTTTGTTGAACAAAACTAGTTCAAA
CCATGTTTGAGGACCATAACAGCATATTTTCAAGATTTGT
TTTCTTTTCATTAGTTCATATTGTGCTTCATGATGCTTTG
TTGTGTGCTGCATTAAGCAAATAAACAATAAATGGATTGT
GATTCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations