Transcript

slc43a3a-201

ID
ZDB-TSCRIPT-141209-2720
Name
slc43a3a-201
Previous Names
  • dkey-59p5.4-002
  • slc43a3a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048533 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048533|OTTDARG00000034321|ZDB-GENE-110208-8 slc43a3a|OTTDARP00000038066 DKEY-59P5.4-002 LG_ CR848663.22 Danio rerio protein_coding NOVEL, 2190 bp
AGCAGGCTCATGAACGCGCACACACGTGCACAGTTTCAGT
GCTGTTCTTCAGCACAAAACGGGAACCGACAGCGCTTCAG
CAATCCCGCCGTTCACTTCAGCGCGAAAAGACTGTCCTCT
TCATAAACACCAGACACACGTGCCACTTTATAGGGTAAAC
ATTTTTTAGGGATACGTCCTCAAACTCAAACAACAGCATC
ATACAAAGATGCTGACAAAAAACATTGATGAATATCATCG
CACAAAAAGCTGAAGACGCATGTTGTGTCATGTTGTTTTC
ACCAGCAGATCTACAACAACTCCCTCCCTTGAGAGGAGCA
TGCACAACTTCAAGTTAGCTCAAACACGTGGAAAGCTTTA
TCTCGACCACCACATAACTGGCATGCATGGTGCGTTTCTG
ATCAAAAGTGAGCAAGCGGTGACAAAAACAGGTGGAGTGT
ATCACAATTTAATTTAGAAACGCAATGGATTCAAAAATTT
AAATTATTTGAAAAAGAAAGTAAAGCAAGCATATACTTTC
TACATTCCTACACAAGTGGATAGTTTTAGAAGTGACCCTA
ATAAAGAGGATGATGGCATACAAAGGATCATCGGGGAAGG
TTGTAAGATACAAACTGACTCTGGCAACTGGACTTCTAGA
GTGTTTGTGCTTCGCTGGGGTCGTGTTTGGTTGGGCGTCT
CTTGTGTTTGTCCTCAAGACAGATGGTTACTTCGGCGACC
TGTGCAGCAACGCGACAGATGCTGGTGGAGAATTCAGCTC
AGACTGCGGTCTGCAAGATGAGCATTTCTCATTGGTCTTT
ACCGTGGCCTCCTTCATGAACAACTTTCTCACTCTGCCCA
ATGGTTTCCTCTATGACCACTTTGGCACAATGGCAACACG
ACTTTTGGCTATATTTCTTTATACCACCGGCACATTAATT
GTGGCATTTTCCAATAAAGCTCTATCTGTGCTGCTTTTTC
CTGCTCTGTCCTTCATAGCTGTGGGCGGCATTTTATTTCT
AATGACAAATATGCAGGTGGGGAACCTTTTTGGTTCTCAT
AGATCAACTATTATCACAGTTTATAATGGGGCCTTTGACT
CGTCATCAGTTATCTTTCTTATCATTAAAGTGCTTTATGA
GAAAGGTGTCTCTCTTCGCTCTTCATTCCTCTTCCTCTCA
GCCTGTAACCTCATTCATCTCATCCGGACTCTCTTCCTTA
TGCCAAAATCACACATTCCATATCCCATCCCACAGGACTA
CCAGTATGGGATAAGCTGTGCTAAATCAAATAGCTACAAT
GTTGAAGAGTATGAGGCGAAGCGAGAGGCGAGTTCAGACA
GAAGCAGAAGAGCAGAAGAAGAGCTGCTGGAGACGGACTC
AATAAAGCTAACCGACAACCCTGAGAAAGACAGTTTTAGG
AGCTGTGTCCTGTCCTGGTTCTTCTTGTGGCACCTCGTAT
GGCTGTCAGTCATGCAGCTCCGCCATTATTTCTTCATCGG
TACTCTGAACCCAATGCTGAATAGACTGGCCAATCAAAAC
CCTGTCACTGTGAGCGAGTACACCAATGCGTTTGCTTTCA
CCCAGTTCTGTGGGGTCCTCTGCGCTCCCTGGAATGGCCT
GCTAATGGACAGACACAAAAGAAAACCCCTAGATCCAGAT
GTATCAGAACGGGAAGCAGACCTGCGCTCGTCCATCCTTT
CTCTGCTCCTCACTTCTCTGCAGTGTTTCTTGTTCTCCAT
CTGTGCAAGCATCCCGTTCCTCCCTCTCCAATACCTCACA
TTCATCCTGCAGGTCCTTAACCGATCTTTCCTTTACGGAG
GGAATGCTGCGTTCATCAGCATTGCGTTTCCTGCCAGACA
TTTTGGGAAGCTGTACGGTCTGGTGATGTCTTTATCAGCT
GTGGTGTCATTGCTTCAGTATCCCTGCTTCGCCCTCAACA
AAGCTCTTGGAGGAGACCCACTCTATGTGAACATCTTATT
GACTATCCTGACTCTACTGGCCTTCATTCATCCAGTCTAC
GTGTTTCTCCACTGCAGAGAACTGGCAAAACACAGAGAGA
ATTCTAGGACTTTGGAAGCGTCAATACAGGAAACATCCAT
GTATTAAATTAAACCACAGTACTTGAATATGCAAATGATT
ATGCAATTCTATATAGGCCTTATAGCTTTGGTAGGTGACA
AAGGGAAAATATTAAAGGGAATGTTCACCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations