Transcript

fam193a-201

ID
ZDB-TSCRIPT-141209-267
Name
fam193a-201
Previous Names
  • ch73-153l18.1-001
  • fam193a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048364 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048364|OTTDARG00000034227|ZDB-GENE-080917-25 fam193a|OTTDARP00000037945 CH73-153L18.1-001 LG_ FP102961.6 Danio rerio protein_coding NOVEL, 2064 bp
CCTCCCGCTGCACCAACCAGTAGGAACTATGCAGAGATGC
GGGAGAAGTTGCGGCTGAGGTTGACTAAGCGGAAGGAGGA
ACAACAGCCCAAGAAGGAAGAATTGGTGCTAGAACGGGAC
GGGGTGGAGGACCATCGCAAGGTAGAAGACCTGCTACAAT
TCATCAACAGCGCAGACAGCAAACAACAAGGCAGCAGCTC
CAAAGCAGCCAAACGTGCCCGTCACAAACAGAAGAAGATG
GAAGAAAAAGCTCGTCTAGAGGCAGAAGCTCGGGAACTTG
AGGAACAGCAGCAGCTTCTTAAAGAACAGAGGCGGCGACA
GCAGGAAGAGGAGGCGGCACTGAAGCAGGAGCTGCTCCAT
CTGCAGGAAATGCAGCAGTTGCGGGCATCTAAGAAGAAAA
AGAAAGAGAGTAAAGTCAAGGAGCTGCTCGCCAAGTCTGA
AAACCCTTCTCTCGTTCCTACAATCAACAGCCCTCAACCT
CTACAGCAGACAGCTCAGAGCGTTTTAGAAAAGAACCTGC
AGAACGGCAAAACGCAGCTACTGCACAGCCTCATTCGCCT
CAGTCCTAGAGAGCATTGTCTAGAACCCCAATCCCTCATC
GGTGGGAAGAACACCTCATCGCAACAGCCATGCCCAAAGA
CTTGTAAAGAGAGGCCTTCAGAGTGTCCTGCCCTCCAGAA
CGGCACCTCCTTCTACCCAGAGTCAGCCCACACCAAGGTG
AAACCCAAACAGCAAGCAAATGGCTCCAAAACCAACGGGG
AAGCCACAAAGAGGCCAGCGGAGACCTCCAAAGCTCCAGA
ACCTCCCAAAGCTGGGAATGTGGCCAGCCCTCAAACTGAC
ACCAAAGCCAAGCAGAGAACATCAGAGGAGTCTGTGACCG
ACATCAAGCGGGAAGAGAGGACTAGTGGGAAGAAGCCACA
GAATGGAGGGAAAGACGAGAGGAACTCTCCTGTTATTGAA
CCTCCAGCTTCAGACTCTTCTCAGCAGAATGGCAAAGTCC
CAAGCAACGAGTCGCCTCAGCCCAAAAGTAAAGCTAAGAA
GAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATA
GATGATGTATTTCTGCCCAAAGACATCGATTTGGACAGCG
TCGATATGGACGAGACTGAACGCGAGGTGGAATATTTCAA
AAGGTTTTGCTTGGACTCGGCGCGACAAACAAGGCAGAGA
TTGTCCATCAACTGGTCCAATTTTAGCTTGAAGAAGGCCA
CGTTTGCTGCCCACTAATGGGTCTTCCTTTCAAGAGACAA
TGGCAGGAATTGATAAGCGTTCCTCTGGTTTCTTCTCGCC
CTCTCCCATGTTTCAACAGACTGACTGCTGACCCCCAGTG
CTGCTACGCTTCAAACGCTCCTCCGGTCTACATTATCCAT
GCCGCCTTGCCTTGTCCTTGTTGCTGTGGGTTCCACAAGG
AACCAAAACGGGCTTATATTCCTGCAGTACTTCTGGAGAG
AAAACAAAAAGAGCAAAGTCGGGGAAAAAAAGAATCAACC
ACAAAATGCTACTCTATGAGTTTATCCCTATTATTTTGGT
TTCCCTTTTCTTCTTTTAAAAAGCGTGTGCTTTTTTGTCA
GTGAGTGGGCCGTCTCCCTTTGGTCTGTGTGCCATGTTCT
GGGTTTTCTCTGGCTTTATGTACATTAGGATGAAGGCACT
TCAAAAGACATGCCTAATGAAAAAAAAGACGAATATGGAG
AAAAAAAAGAGATGCTTTTATTCAAATCAACTGTGGCTTT
GCTCACCTTTGCACCTAGCACTGCACTTCCTCACAACCCA
TTGTCAAGAAAGTCGGACCGGTCAGCCTCTCGTCAATACC
CCCTCTACCTCTCCCTTCATTGGGAGAACTGCTAATACTT
GACAATGTTCACGTCGGTTTTTCAGTTCCACTTAAAATTG
TTCAGTGTAACAACTCCGTTCAAGTTATAAACTTATTTTA
TTTTTGTTTTTTTGTTTTTTTCTTTTGTTTTTTTTTTTTT
CCAACTTGTACCAAGCTTGTATCAGAAAACTTTCGGAATT
GAATCGAAAAGAACAATACTCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations