Transcript

abtb1-202

ID
ZDB-TSCRIPT-141209-2663
Name
abtb1-202
Previous Names
  • abtb1-001
  • ch73-272m14.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045460 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045460|OTTDARG00000032527|ZDB-GENE-141212-241 abtb1|OTTDARP00000035903 CH73-272M14.1-001 LG_ CU862015.9 Danio rerio protein_coding NOVEL, 6412 bp
GCTTCCTGTTTACATTTTGCAGAGCACTTTCACTGCGAGC
AGAAACAGCAGAGACATCGCCTCAAACTCCTGGAAACAGG
CTCCGAGCTACAGTAGTTGTGACCCGCCGCTGTCCGTGCG
CCTGCAGCCGATCCTGTCTGATAGACAGGCCGTTTCAATG
CATTTCAGAGAAGCTTTACCGCCGCGCAGATGGACGCTGT
TGATCTGTTTTCAAGCTGCAGAAAGGGCGACATTGCCAGA
GTGAGATACTTGGTTGAACAAAGGGATGTAGAACTGAACA
TCAGAGATAAGTGGGACAGCACACCTCTGTATTATGCATG
TCTCTGTGGACATGAAGAGCTGGTGCAGTACCTGCTCGCC
AACGGAGCAAAGTGTGAGGCGAACACGTTTGACGGCGAGC
GCTGTCTGTACGGAGCTCTGAGTGACGCAATTCGTCGTCT
GCTCAAGGAGTACAAGCGCATCACAGCCAAGGCCATGCAG
AGAGACTATTACGACCAGTTCCTGCAGACGCTTTTGGAGC
AGGGAAACTACAGCGATGTGACATTTGTGGTTCACGGGGA
GATGTTTAAGGCCCATCGGTGTATCCTGAGTGCCCGGTCT
GAATACTTCGCCCACATGCTGGAGACCAAGTGGAAAGGCA
AGAGTGCCATTGCACTCAAACATCCACTGGTCAATCCTGC
TGCCTTTGGTGCGATCATGCAGTATTTCTACACCGGTCGT
TTGGATATCGATGTGAATTACGTAGAGGACTGCAAGCGTT
TGGCCAAACAGTGCAAGATCGGCGAGCTCATTGAGGAGCT
GGAAGTGAAGTGCAAACAGGTTTATGAGTTTGTGTCCAAT
AAGCCGGGCACGTGTGTGAAGGTGTTGACTCTGGATCCGC
ATGACTTCCAGCTGCAGGACGGCATGGCTCTGCTGGCTGA
CAGTGCACTTCCTGCAGAGCTGCGGGTCGGATACGGTCAG
CTTCCATTCGATCTTACTGACAGCTTCCCGAGTTATCCTG
ACATCTGCTTCCGGGTGGAGGGTTATGACTTCCTATGTCA
TAAGGCGTTTTTCTGTGGCCGCAGTGATTATTTTAAGGCT
CTGTTGGAGGATCATTTCAGCGAGGGAGAAACTCTACAGA
CTCATCCCAGTATTCCTGTCATCACGCTTCATGATGTGTC
CCATGATTTGTTTACAAGAATCCTTTATTACATTTATAGT
GACAACACTCAGCTGTCTCATGAGAATGTGTATGAGGTGT
TGTGTGTGGCCGACATGTACCTGCTGCCGGGTTTGAAGCG
TCTGTGTGGCCGAACTCTGGCGGCGCTGCTCAATGAGGAG
AACCTCGTTGAAAGGCCGGAGTTTGCCGACATGATCAGAG
AGGATGCTGGGAATGTGGCCGCCAGACAGGAGACGGACTC
CATTCCTCTGGTGGACGAGATCCGCTTCCACATCGCCAGT
AATGTTCAGACGTACAGCGCCATTGAGGAGGCCAACCAGA
AACTGAGCGCCCTGGAGCTCCTGCTGGCCAGCATCGGCCT
GGAGTGCTGAAAAACACGTTCAACGCTGCACACATGACCT
GCAGAAACACAGCTGAGCACACATCACTTGTAGCAAACTA
CTATAATCGAGTCTAACCAAAACCAGATACTTAAAACGTA
TGGCAGGCCATGTTAGCCGAAAATGTTTCCAGCGTTACTT
GACATAATTGCATGTTTACAAGTAAGAATTAGAGCTGTAT
AATTGAGTTTTTTCTAGCAATTTGAGAGCTCTCGAATTTA
ATTATTTATATGAACAATTCTAGTTAGAGAGCTCTATAAA
TGATTGTTTACCTGTCATGAGTCTTAATTACTTTCCGTTC
ATTTTCTAAAGGGATATTTCACCCCAAATATTACAATTGA
CTCTATATTTGCTCTTCGTTAAGTTCATTATCTTTGTTAG
GTTCATTATTCTGTTAAACACAAAAAAAGATTTTTGGAAG
AATGTTGGATACCTTTAACCATTGATTTCCATATTAGGAA
AAACAAACACTTTTGAAATCGATGGTTACAGGTTTCCAAC
TATCCCTTTAATTAAAGACTCTGTTGTTGAATTTGCACTA
GTAAAATACCAATTAGAATGAACTACAATTACATTCATAC
TACTTATAATTCCAGTTAGAGAGCTCCACAAATGAATGTT
TATTTGTCATGCAACTCCATTACTTTCCTTTGATTATCTA
AAGGGATAGTTCACCTCAAATATTACAATTTACTCTCTAT
TTGCTCTTCCTTAAGTGTTTCTAAACCTTTGAGGTTCAAT
ATTCTGTTAAACACAAAAGAAGATATTTTGAAGAATGTTG
GAAAACCGGTAACCATTGACTTTCATAGAAGGAGAAACAA
ATACTGTTGACATCAGTTCCCAACCATCCCTTTAATTACA
GAGCTCTGTAGTTGAATTTGCACTAGTAAAATACCAATTA
GAGAGAACTACGATTAAATTCATACTAGTTATATTTCCAG
TTAGAGAGCTCTGCGAATAAATGTTTACTGGTCATCCATC
TCATTTACTTTCCGTTCATTTATTACAAGCATAGTTTACT
ACAAAATAAATTCATTTACTCTTTAATTTCTGTTCAGTAA
GTGGTTCCAAACCTTTATGAGGTATATTATTCTGTTGAAC
ACAAAATAAGAGATTTTAAAAAATGTTAGAAACCGGTAAC
CATTGACTTCCATAGTAGGAAAATCAAATACTGTTGAAGT
CAGCGGTTACAGGTTTTTTCAAAATAACTTGAAGGGAGAG
TAAATGATGCCATACTATCCCCTCAATTATAGAGCTCCTC
GGGTGAATTAGCACTAGTAAGAAAAAACATTTAGAGAGAA
CTACAATTAAATTTGTCTGAGTTATAATTACAGTTAGAGA
GATCTACAAATTTTTTTTTACTAGTCATGAGTCTCCATTA
CTTTCCGTTCATTTTTTTAAAGGGATAGTTCACCCCAAAT
ATTAAAATTTACTCTCTATTTGCTCTTTGTTAAATGTTTC
CAAACCTTTAAGAGGTTCATTATTCTGTTAAACACAAAAG
AAGAGATTTTGAAGAATGTTAGAAAGCGGTAACCATTAAC
TTTCATATAGGGAAAAACAAATACTGTTGAAGTCAATGGT
TACAGGTTTCCATCCTTTTAATTACAGAGCTCTGTAGTTG
AATTTGCACTAGTAAAATACCAATTAGAGAGAACTACGAT
TAAATTCATACTAGTTTTAATTCCAGTTAGAGAGCTCTAC
GAATGAATGTTTATTAGTCATGCGTCTCCATTACTTTACG
TTCATTTTCTAAAGAAATAGTTAACCCCAAAGTTAAAATG
CACTCTATTTACTCTTTATTTAGTGGATCCAAACCTTTTA
GTTTCTTCATTCTTTAGTACACAAAAGAAGAGATTTTGAA
GAATGTTAGAAATCGGTAGCCATTAACTTCCATAGTAAGA
AAAACAAATGCTGTTGAAGTCAATGGTTACAGGTTTCCAA
CTTTTTTCAAAATATCTTCTTTTGTGTTCAACAAAAGGAA
GAAGCTCAAACAGGTTTCTGACTAGAGGGAGTAAATGGCA
GAGTTTTCAATTTTGTGAAAACTGTACCTTTAATTATAGA
GCTTTACAATTTAATTAACGCTAGTAAAAAAAAACAAAAA
AAAAACAAAACAATTAGAGCTCTAGAAATAAATGTTTACT
ACTTATGCGTCTCTTACTTTCCATTCATTTTTTTAAAGGG
ATAGTTCACCTCAAAAATTAAAATGCACTAATTTCTCTTC
AATAAGTGGTTCCAAACCTTTATTCTGTTTAACACAAACA
AAGATATTTTGAAGAATGTTAGAAACTGGTAACCATTGAC
TTCCATAGTAGGAAACACAAATAGTAATGTCTGTAAACAT
GTAAAAGTCTTTTTCAAAATAACTAATCTTATGTTTAACA
GAAGAAAGCTACTCAAACAGGTTTCTGACAAGTAAAAGAT
GAGTTAATCATGATAGAATTTCCAGTTTTGGGTGAACTGT
CTCTTTAATTTAGAGATCTGCAATAAAATTTTTACTAGTT
TAAAAAAAACAATAAGAGAGCTCTACAAATAATTTTTTTA
CTAGTCATGCATCTCCATTTACGTTTATTTCTCAAGAGAT
GGTTTACCTTAAAATTAAAATGTACTCTTTATATACTATC
CATTAAGTGGTTCCAAACCTTTAAGTTTCTTCATTTGGTA
GTACACAAAAGAAGAGATTTTGAAGAATGTTAGAAACCGG
TAACCATTGATCTCCATAGTAGGAAAAACAAATGATGTTG
AAGTGACTGGTTACAGGTTTCTAACTTTTTTCAGAACATC
TTCTTTTGTGTTCAACAGAAGACAGAGACTTAAACATGCT
TCTGACAAGTTAAGGGGGAGTAGATGATGACAGAGTTTTC
AGTTTTGGATAAACTGTACCTTTAATTGTAGAGCTCTGCA
ATTTAATTTGCACTATTAGAGAGCTCTACAAATGAATTTT
TACTAGCCATGCGTTTCTATTACTTTCCGTTCATTTTATA
AAGGGATAGAAAATGAAAATTTACTCTTTATTTACTATTT
GTTAAGTGAATCCAAACCTTTAAGTTTCTTTATTCTGTTA
AACACAAAAGAAGAGATTTTGTAGAATGTTTGAAAGTGAT
GACCATTGACTATATAGCTCTGCAGTTAATTTTTCTATAG
TAAAAAACTATTCGAGAGCTCTAGAAATAAATGTTTATTA
GTCATGCATTTCCGTTCCATTTTTTTAAGGGATAGTTCAC
CTAAAAATGAAAATGTACTCATTTCTATTCAATAAGCGGG
TTTCGAACCTTTATGAGTTTCTTTATTTTATTCTACACAA
AAGAAGAGCTTTTGAAGAATGTTAGAAACCAGTAACCATT
GACTTCCATAATAGGAAAAATGAATATCATTGAGGTCAAT
GGTTACCCCTTTCCAACTTTTTTCAAAATATTTTCTTTTG
TGTTCAACAGAAGAAAAAAAACTCAAACATAATGGTGACA
AGTGAATGATGAGTAAACAAAAACAGAAGTTGAACTGTGC
CTTTACAGAGCTCTGAAGTTTCATTTGCACTAGTAAAACA
ATCTAATCTACAGAGAACTACAATTAAATCTAGTTATAAT
TCCGGTTAGAGCTCTCTGAATATCTTTTTACTAGTAAATA
CTCTAATTTTTGAGCTCTTTGTTTCCTTTTTTTTATTAGT
AACACTTAGAGTGATCTCCAATTAAATGACTGCTAAGACG
AATACAATTACTGACTATTACAGTTTTACTAGTTAGAAAA
AAACATTAAAAATATGTTTAGTTGCATGTCTCTAAAATAC
GAGATCTCTCTAATTATATAGTTAAATAAAAAAAACTATT
AATAATAACAGAATTGTATTCTAGAGCTCTCTGATTAAAT
AATAACCAGTAAGAAGGAAATGCAGAGCTCTGTTATTGAA
TAAGCGAGCTCTTTAATTTCACGTTTACTAATTGATTGAC
ATTATTAGTATTTAATCGTGAATCGCTGTCGTTTCATTCT
CACTATTAAAAGTGCAAATATAACTAGTGATGCTGGAACT
ATTTTAGGCTAAATCGCCTTGCCATATACGCACATAGAGT
CTGGTTTATTGTATTGCAGTGGGGCTGTTGTGATCCAGTA
AAGCTTCCCGCCTTTAGTTGTTTTCCACGAACAAAGCTTG
ACATTTGCATCATTTCAGCGTCGATATTAACATTCAGTTC
TTTCGAATGCCTCGTTTTCCAGATGTAGCAGAAACTTTAG
GTTAAGAAGCTTCCAGTTAAAACAATATTACGTCATAGAT
GTTACATCACCGAATAGGATTCATTCTGGAAGGAAAGATT
TATTTACGTGCGTTCATAAATAAGTTTGAGCTCATGATAG
GACCGTTAATCAGATTTATTTTCCTCTGATATTTGTGTGA
TAGTTTGCCGTTAATTAAAGCATACGGATTATTATTTATG
CCTCTAAATGTGCGTTCACTCATGAATATATCTTCCAGCA
CTTACGTTCCTGAAGCTTTGAATTTGCAGGAATGGCTTAT
GCTAATGTGCATGCAATATTTGCATCAGTGAACCTGATTT
AATCGTTGTCCTCAAACGTTTTCCCTGTTTTGATTTTATT
TTCAGCCTTTTATTTATTGTTTTATGCTGGTCTTAAAGCG
ACACGTCGATGAGATGTGGATCATATTGCGCTTGTTTTCC
ACTGCAGCACTTGGTGAATTTGTGTAAGATTGAGTTACTG
AATGGGCTGCTCAGGAGAAACTCCCACAGGTGAGACTGAT
TTATGAATATTCATGAATGTCAAAAGTCATCTGTTTACGA
TCTGATTGGTTGGCATTTATATGAGTTTTTGTGGGAGACT
ATGACTGAATGGGATGTACATAGGTGAGCAGAAATAAATA
TTATTTAATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations