Transcript

rlim-201

ID
ZDB-TSCRIPT-141209-2652
Name
rlim-201
Previous Names
  • rlim-001
  • ch211-67o16.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044736 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044736|OTTDARG00000032082|ZDB-GENE-120809-2 rlim|OTTDARP00000035395 CH211-67O16.2-001 LG_ CR383680.20 Danio rerio protein_coding NOVEL, 5016 bp
CGTACTATTACGCACACCGGAAGTACATTCGATGCCGAAG
AGACGCCTGAGAAAATGAACTCCTGAATAGCTGTCAAGAT
TAAAACTTACAAACATCTACAGGTCACTAACAGTAACTAG
ATAAGGCGTCGACGAATTTATTAAGTTGGATCTGATACCT
GGGTCACAGTGATGGAGGGTCAGGATAATGCAGATCAAGG
CAGCAGTGATCAGTCTGAAATACAACGCAGAAGGCAGCTG
GACCGTCTGGACAGAGAGGAAGCTTTCTATCAGTTTGTCA
ACAATCTTAGCGAGGAAGATTATAGGCTCATGAGAGACAA
CAATCTACTTGGCACCCCTGGTGAAATCACAGCAGATGAA
CTGTTGAACCGACTTAGGCAGGTCAAGGATGGCCCTGAGT
CACCCAGCAGTAACATCACTGAAGAAAGAAGGGAAGCGCC
TGGAGCGACAGAGGTTGAGGGCACTGAAGAAAACCCAAGT
GGGGAGACCCTTCTTGACTGGCTGAACACAGTACGACAGA
CGGGGAATACAACTAGGAGTGGTTACCGGGGTAACCAGTC
ATGGCGGGCTGTGAGCCAAACCAATCCCAACAGTGGTGAT
TTCCGTTTCAGCTTGGAGATCAATGTCAATCGTAACATTG
CTGAGCAGCAAACACAGACAGAAAGGTTGGAAGGCAGCCA
GGAAAGACCAGATGGCTCTGTTTCTGAGCCTGAGAGTCTT
ATGGAGACTGCAGAGGTAGTTGAGGAGCCAGTTGTGGATG
AGTTGGCTGTTATTGTAGAGCCAGAATTGCCAGTTCCTAG
CACATTGACTCTAAACAGAGATGATAATGTACCAGTAGAT
GCACCAAATCCACTAACCTCAACTCCTCCAAACTTGCCTT
CAGTGGAACAACCCCGTAGGGGTCAAATAAGGGCTCGTAG
CAGAAGTCCAGAGCAGCGACGGACAAGGGCTCGCACGGCA
AGAGGTCGTTCACCGATCAACCTTGAAAGATTGGATGGAC
TCCCGCCTACCCAGCATGGCATACCTACTCATAATCCTGA
GATACTTCCTGAGCCACAGGTTGAGGGAAGCTCAAGGACT
CGGCAACTGTTTTTATCTAGGCAGAGCACAGTGGAAACGG
AAACTCATACTTTGGGATCAGCAACTGACGTACCTGAAGC
ACCTCAAGAAAGAGAGGCAACTACTGGAGAAGCAGGGGCC
TCAGGACGTCGTCCTCCAACCATAATGCTGGATTTGCAGG
TACGTAGGGTGCGTCCCGGAGAGTATCGTCAGAGAGACAG
CATTGCAAATCGTACAAGGTCTCGTTCGCAGACTTCAAAC
AACACTTTATTATACGAGACTGAGCGTGGAGGTTTTCGCC
GGACCTTCTCCCGTTCTGAGCGAGCAGGAGTAAGAACATA
CGTCAGCACTATCCGCATTCCCATTCGTAGGATCTCGGAT
GCAGGACTTGGGGAAGCCACTTCTTTGGCTCTGCAGTCTA
TGATTCGTCAGATCATGACTGGCTTTGGTGAGCTTAGCTA
TTTTATGGAAGCTGAAGTTCCAGACTCAAATCGTGAAGAC
AACCCACCAGCAGACCTCTCTGACGCACTGGGAAACCCTG
ATGCTTCTACTGGAACTGGTGCAAGTGAAGCAGACCCCTA
TCTTCCCGGCCATGGAGGCTTGAACCAGGGTGGTTTAGAG
GCAAGGACTGAGGAAAGGGAAGTGGAAGGTGGACTACCTG
GTGCTGCTGGACCTCGGGAGAACCGAGGGCGACAACGGGC
TCCGATCAACTTGGATGAAACTGGATCACTGCCCTTCCTG
CGACTTGCGCACTTCTTCTTGCTCAACGAGGAAGATGACG
ACCAGCCCAGAGGTCTCACCAAAGAGCAGATTGACAACTT
ATCCATGCGAAACTTTGGCGAGAGCGATGCATTCAAAACT
TGTAGTGTCTGTATTACAGAGTATGCTGAAGGCAACAAAC
TGCGGAAGCTGCCCTGCTCTCATGAGTACCATGTGCACTG
TATCGACCGCTGGCTATCAGAAAACTCAACCTGCCCTATT
TGCCGCAGGGCGGTGCTCATTTCCACCAACCGTGAGAGTG
TTGTCTAGCTAAAATGAGATTTTTCTGCCCTTTGCTTTAT
ATTTACCTAGTCATGTGAGGACTCTTAATGAGATTTCCCC
CCCATACATCTTATATAAAGCCATCAAGTTTTATCAGATT
TGCTGGTGCCAAGATCTCCCCACCCCCAAACTTTATGGCA
GTGTGTTTTGACACATCTTACAGTGGAATAAGTATTGTTG
CAGGACAAAAACGGTGAAGGCCATGCTCCAGCCCTGGTTC
TTCACTTCTATTAAATATCAACATTTGACAAAATTCTAAG
GCAATGCAGAGATCCCTTTGTATGGTACATTTACTTTGTT
CAAAAAAAGAGCACTGTGCTGCATATGTTTATGTGGTTTC
ATACAGTGTTGGTTGTGTTGGTATGAAATCATAGTATGTG
TTGTACCAGTTGCATCATAAATGACTAAATGCAGATGATC
CGAAAAAGATTTCATGCAATAGTTTTAAGCGAGTTTGTCA
TACTCTGTAGAATAGACTTTGATTTGGCATTTAACCATTT
TCTGTAAACCTGGTTTTAAAAGCCATGTGATCAGACACTT
TTTAAACAAACCAACCAACAACAAGGCTGTAAATATGCTA
CACGGACACATCAGGTTGTATTTTCGCCTGTCTTCCCAAA
TGACGATGATGCATCAGTCTGCGGATTCAAAAGCATCTTT
CATATATCTTAAGTAATAAACTTGGCTATGTATAGGCAAT
GTTGTGCAATGCTAATAAGGAAAATGTAAAGGATGTTTTG
CCAGATTGACTTGTATGTTGTAGTCTGTAAATATTAACAT
TTAAAATGAAGACTTAAATGGAAGTTTTTCTAACAGTTCT
GTACATTGAAAATAGCACCATTTATCTACCATTTATCATT
AACGTCTGAGGAGGAAATTATTTTTTCTCATGGAATGGTT
GGTTTCTTATATGAGCTGAGGTTATTAAGGCTGATGTGAG
TGAGAAATGCAGTGTCCTTTAGAAACGATCTATTTTCATT
GTTTCTTTGTTCACTTGGGAGACTAACCCTAAGCATAATG
TTCTCGAATACATCAACATTTCATGTCTCGTAAGCAAGCC
AACCCTCATTAAATGCACACTCTTCTTCAGTTCTGAGGTC
ATGTATTATGAGAGCGAGCTCCTCAATAGAATTTCTTAAT
TTTGTCAGCATCATATTTATAGCCTATTTTTGAGTCAGAT
TTTGACTAGCTTCCACTTTGCTGTGTTTAAAATGAATAAA
ATTATTTCCTCACCTGACCGTTTTCTCTGTGGCCTCACCA
GTGTCCCCATCCTGTTAAGTGCTGCTTCAGAATAAAGAAA
AATATCTTCCAGCCTCACAATTGATGAATCCAATTAGCAA
TACATATTTGGACATCTTAAGAACAAGCTGTGATGTAAAA
TTAAATAGGTTATATATAATGAATATGGGACCAAGGTGCA
GTGTAAGACTGGCAATCCAGAGCCTGAGACATATACACAT
GCATATATCTATGATCGGAAACGGCTTGTTCACTAAGCCA
ACAATAACACAAGTTTCTGGCACCGTAAATGTCAGAAACG
TAGATGTCGCCTACGCTATTGTTGTCTATTGGAAGGAATG
CGTCAACAGAGCCGCCATTTTAGTACAGGGTAGCACTCCT
TTGAAATGAATGTGGGACCAAGGTGCAGTGGAGGACTGGG
AATCCAGAGCCTGAGACAAATACACATTTACATATATCTA
TGATCGAAAACAACTCGTTCACTTAGCCGACAATAAGTTT
CTGGCACTGCAGTATTTTGTTGTCATCTTTGATTTACATT
GCTTATTTTTTTCAACAAAACTAGCATAATCCTAGTATTT
AGTTTGAGTTGCTGCTATTTTGCCTCATTTTCAGTGCAGT
AAGTGACTATTATCATCAATAACATTACTTGTTGAGCACA
AAAAACAAAATCTTACCTATGAAATGTTCTGCCTTTATGC
TTTGATTTTTTGCTCTTTCTACACCCGTGCACAGCGGGTC
CAGCATCTTTACATTGGCTTTAGTATTAACAAGTGAATCC
AGATACTGAGTTGAATGACATTTGTCCTGGGAGCACTGTA
CAAATGTGGCGGCGCTATTGACACATGCTTAGGGTCTGTA
TGCGATATCTAGTGTAAATATCTATGGTTCAACGCAAGTG
CTAACTACTTACACAGATGTTGCTTTACACAGATTTTTTC
TGTCCTGGCATCATCAAATTTATAATTTACAATAAAATTT
GGGCGGCAAGAAAACTGCTATGTTTTATTATTAATTTAAG
AAATGAAGTTTTCATTTAAACCCAACTATCCTGTAATTCT
TTGTAATTGACAAACTCAATATTTTACAGCCTGTTCACGC
CAGTACTTCGCATTCTAAACTTTTGGTCTGATTGACAAAA
ACATGTCTTAATACCAGGTCTGAACAGGGCCTTTTTTCTT
AAGCTGAAGTCAGCTTTTTTAAAATCAAAATTAAATCTAA
GAATTATATCAAGATGCAATTTAAAACTACTCAAAACAAA
TGTAATGTGTAGTTTTATGGGAAATAAACTTTTTTTTTTC
CATTATTATCCAAACGCAAGTTTCTATAAGCTCTGGAAAA
TAATCAAGTGACTGTTATCAGACCTTGTTGTTGCTATCCA
TGTTTGCCATCCCAAGATATTTTAGAAATCCAGACCTGTT
GACGATGTATGTTTAGATTACATACATCTATACTAGAGTG
ATTTATTGTAGTGACGCAGAAGATTGGTCATATATGAACA
GCATAAATCAAATGTCACGGTGTCAATAATACTGTATCAT
TAGGTACGTCTTGTACATTGTACACTTGTATTTCATTTAA
GCACCGCTAGGCGTCACAGTGGCTTCATGAATGACTACTG
ACAAAGACGCAAATAAAGTGACAATAATCATGCGTAAACA
AATAAAGTTTATATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations