Transcript

dixdc1b-201

ID
ZDB-TSCRIPT-141209-2636
Name
dixdc1b-201
Previous Names
  • dixdc1b-001
  • dkey-183i3.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043406 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043406|OTTDARG00000031211|ZDB-GENE-041008-148 dixdc1b|OTTDARP00000034415 DKEY-183I3.3-001 LG_ CR450711.21 Danio rerio protein_coding NOVEL, 2198 bp
ATGATCGCATCCTTGTCTAAAGGAAACCTGCTTGACGTGC
TGCAGGAGGGTCCCAATGAGCAGCAACTGGCTGCGTATGT
GTCCTGGGTTAATGCTCAGCTGAGGAAGAGACCAGGACTG
AATCCTGTGAGTGATTTACGACAGGATCTCAGAGACGGTG
TGGTACTAGCACACCTCATTGAGATAGTGGCTGGTGAGCT
GCTGGATGGCATTTATTATGAGCCACGGGACGATCAGGAA
AAGAAGCAGAACGTGGAGAAGGTTCTTCAGTTTGTGTCAT
CCAAACGGATCAGAATGCCACAGACATCTGCCAGGGACAT
TGTGGAAGGGAATCTCAAATCCGCAATGAGGCTCATCCTC
GCTCTTGCTGCACATTTTAAACCCTCCGCATCAGCCAATC
ACAGAGCTGGAGCTGGTGTAAGCAGGAGTTCCACTGGCTC
ATCGGCCAATCACAGACCTCATTCCGCTATGGCCATGGCC
CAGAATGCAGCAGCAGCACTGGCAGCAGCCAGACAGGACG
CTTCTCGCCCTGGCCGTTCTGTCTTTCACCTCAGGCAAGA
ATGGAGTCGCAGCTGCCTTGGTGATGAGGAAGGTGAAAAT
CCCTGCTGGAGTGTTCGAGCACTGGTTCAGCAGTATGAGG
GACAGAGAGGCTCATTTGAAGAGGAGACAGGAGCAAAATC
CACAGGCCTCAGTTCACCGAGCCCAACTCACACTCCCAAA
GACTCCATCAGCCTATCAGACGTGAAAGCAGGACTGTTGG
ACGCCTTATCTAGAGAGAAATCCATTAAGTCAGAGGACAC
AGTAAAATTGGCCCTATGTGAGCAGACCATTGTCTCAGGG
CACGATGGTCCTGGTGGTTGCACAAACTGGGAGGACAAAC
TGTGTGAGCAGCTGGAGAGGGAAATGCAGGAGGCCCGAAA
AATGGTGTCTAGCCTCCAGGCTCTACTTCTACATGGTTCA
TTACCTGAGGATGAACAGGAGGTGTCGCTCAGTCTGGGTG
AGGGAGTCGAAAATGCAGAGCAGCAACTGGTTGTAATTCG
AAGTCGTCTGGACCAAAGCATGGAGGAGTGTCAAGATCTG
AAGGATGCTCTACAGCAGCGTATGGCTGTGCAGGAGTCTT
CAGTCCTGCAGCTCAAACAGGAGCTCCTGCGCTCCAGTAT
GGCCAAAGATGAGCTGGCAGGACAAAATAAAGAACTGGGC
CAAAAGGATCGGCTTCTGCAGCAGCAGCAGATGAAGCTGG
ACGAGGCCATTCGCAAACTGACAGACAGCAGCAGCCAGCA
GGCTGAGGAGCTGCAGTTAGTCAGAGATGCTCTTCGCAGT
CTGAGGAACAGCTTTGGAGGTCACGACCCCCAGCATCACA
CTCTCGACACCCTCGAGCAAGGAGTGTCCAGCCTGATGGA
GCGCATGTATGACCTGGAAACACGCCACAGACATGAGAGG
AGGACCCGAGGCAAATCGCCAGGACATAAAGCGTCTCACT
CAGATCGGGATTCCTGGCCTCCTACTTCGAAAATCGCTCA
TTCTCAGAGCAGTCCAGCACTCAGCTCGTCTGCACTCACC
AAAGTCCTGTACTTCACTGACCGCTCGCTCACGCCATTCA
TGATCAACATTCCCAAGAGGCTGGGGGAAGTCACTTTGCA
AGACTTCAAGACTGCTGTTGATCGGGAAGGCAACTATCGT
TACCATTTTAAAGCACTGGATCCAGAGTTTGGCACAGTTA
AGGAAGAGGTGTTTCAGGATGATGCAGTGGTGCCAGGCTG
GGAAGGAAAGATTGTGGCCTGGGTAGAGGAGGATCATGGG
CAAAGAGGAACTTAATACAAGTCAGCAGCAATCCGTCAAT
GGAAACAGAAATATCTGTGCCAAAAGAAAAGAACATTGAT
TTTGTATCTTAAGTAGAGAATGAAGCTCCTTCAGTCTGTC
CTGCATGAGCTGAACCACAGAATGAAACTGAAAGGACATA
AAGGATTACCCTAAGGATGGAGAAAGTCTGATCTCATGTT
TGTCCAGACCAGTATTACTCGAATATAACAATATAAATAA
GATTTGTGATCTCTTTTGAGGTCTTGCCATAGAACAAACC
AATACCCATTCCAGCAAACACTTCACAAGATGACAGACTC
TTCACTGTGACTCAAGGAGCCTTTCAGATCTCTCAATTTT
CCCTACTTTAAAGTAGATTCTGCCAGATTACTAAATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations