ZFIN ID: ZDB-TSCRIPT-141209-2554
Transcript Name: slc30a7-201
Previous Name: slc30a7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030532 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030532|OTTDARG00000023441|ZDB-GENE-030131-5650 slc30a7|OTTDARP00000024874 slc30a7-001 LG_ BX908733.16 Danio rerio protein_coding KNOWN, 1942 bp
ATTTTACAACACACACACTCTTACACACTAGGGTCAGTGT
CATGACGCACGCGACGTCGACGCCAGGACTCGTCGCTCTC
TTGCGTCCAGACGCTCGTGAAGCCGCAGTGCTGCTCAACG
GCTACCGGAGAGACGCTTGACTGAAAAATGCTCCCGTTAT
CAATCAAAGATGACGAGTACAAGCCTGCCAAATTCAACCT
GGTCGTCAAGCTATCGGGCTGGTTCAGATCAATTCTTGCC
GATAAAACGTCTCGGAATCTGTTTTTCTTCTTGTGTTTGA
ACCTGTCCTTCGCCTTCGTGGAGCTGCTGTACGGCATATG
GAGTAACAGTTTAGGTCTTATATCAGACTCCTTTCACATG
TTCTTCGACTGCACTGCTCTCCTGGCAGGCCTCGCAGCAT
CAGTCATCTCACGGTGGAGGTCTAATGACTCCTTCTCCTA
CGGGTACGTCAGAGCAGAAGTACTCGCAGGCTTTGTGAAC
GGCCTTTTCCTCATCTTTACTGCCTTCTTTATCTTTTCAG
AAGGAGTGGAGAGGGCGCTGGAACCCCCTGATGTGCATCA
CGATCGTCTGCTGCCCGTGTCTATAGCAGGACTGCTGGTC
AATCTTGTAGGAATATTTGTTTTCCAGCATGGAGGACATG
GACATTCACATGGCGGTGATGACCACGGCCACAGTCATTC
TCTGTTTAACGGTAGTGCAGCACACGGCCACAGTCATGGC
GGACACGGCCACAGTCATGGTGGACACGGCCACAGTCATG
AGTCCAAACACGGACACGATCACGGCCACTCGCACGGAGG
ACACGGCCATTCACATGACGATCAGCACTGCCACGATGAC
CACACACTCACACCCGGAAAAGGCTCCAGCAAGCAGATTT
TACAAGGAGTTTTCCTCCACATCGTGGCAGACACACTGGG
CAGTGTTGGTGTCATCATATCCGCCATCCTCATGCAGAAG
TACGACCTGATGATCGCAGACCCCATCTGCTCCATGCTCA
TCGCTCTGCTCATAGGAGTGAGTGTGGTTCCTCTGCTCAG
GGAATCCATAGGGATCTTGATGCAACGGACGCCTCCTTCT
CTGGACCATGCCCTTCCTGAATGCTACCAAAGGGTCCAGC
AGCTTCAGGGTGTCTATAATCTTCAAGAGCCTCATTTCTG
GACCCTTTGCACAGATGTGTATATCGGTACACTCAAACTC
CTGGTGGCGCCTGACGCAGACTCTAGGTGGATCCTCAGCC
AGACGCACAACATCTTCACACAGGTCGGTGTCAGACAGCT
GTATGTTCAGATTGAAGTGGCTGCAATGTAGGAGTCCACC
ACTCTTCTAATCTCTGGGAGTCCCGGGACCAAAGGCCTTC
TGTGCTGCTGTGGGGAAGTTCTCCACCTCAACCCTCTTTG
GGTTTCTGTCGCTCCACTTCTATCTTGGATCAAGATGGAG
CTGGTGCCGTCCAGCAGTCTGACTCCACTCTTGCCAGAAA
ACATCAAACTGAAAACAACTGACCAGCCACAAAAAAAAAA
GGTTTCAGAGGGAAGCAAGAACTTACACCCTCTCGTCTCT
TGAAGTTTCCTGTTGATTTTTATTTTTATAATCCAACCAA
ACGGTTTCTTTTCTTCTAATTGTCGCCCTTTTCCATCATC
AGAATGGGGTTTTAATTGTTGGTGCGAGTGTGGAGATCAG
TGGACATTTGTAAAAACAGCCGTATGTGATTCATTGACTT
CTTTTTGTACATGATCGTCTGCTTTTTGTTTTGTTTTTCG
GTTGTGAAGAGGTGCAGAATTTGCCATAATGTAAACATAT
AAACAGATTTGTCTGCATTTCTTAAGTGCCTTTTTAAAAG
AACGATTATGGACAATCGCCTGGGCAGTGTTTGATGGTCA
ACGTGAATGCGATGAAAACTGGATCTTTGAGTTCTGTCTA
CAATTAAAACATTCCTTTGCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc30a7-201 Contained in:
[BAC] CH211-190N7 (1)

Genome Resources: Vega_Trans:OTTDART00000030532 (1),  Ensembl_Trans:ENSDART00000009464 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044151 (1) 1870 bp
GenBank:CO929079 (1) 671 bp
CITATIONS (2)