ZFIN ID: ZDB-TSCRIPT-141209-2539
Transcript Name: rgl2-201
Previous Name: ottdart00000026738

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026738 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026738|OTTDARG00000021127|ZDB-GENE-010131-1 rgl2|OTTDARP00000021920 rgl2-001 LG_ CR752655.12 Danio rerio protein_coding KNOWN, 2458 bp
TTGGCAGATCTCTGCCTGTCTGGACTCGCAGAGTTGAAGG
GGGAGCCGTCCCCAATGAAGACCACATGGTACTGCCCGCT
GGACCTGTCCACTGTGTCTGAAATGGAGGAGGACGGCATC
ATCTACACTGTGGTGGTGAAACAAGGTCCTGGTTCCCCCA
CCAGCCCTCAGTCTACAGCAGCCCGCTCTCAGCACGTCAA
AGCCGGGACAGAGGAGAAGCTGGTCCTGCATCTCCTTCAC
TCCTTCTCCATGGGCGACTCATCCTTCATCTCCATCTTCC
TCTCCACCTACCGCTCCTTCACCTCCACCCAGAGAGTGCT
GGACATCCTCATATGCAGGTTGGAAAATCCTCCTGGGGAG
TCTCACAGCAATAGCCGTCAGATGTTCAACAAAGCGGTGT
GTACAGTGTTCAGTACATGGATGACTGACTATCCTGAAGA
TTTCCGTTCTCTGAGTGACCCGTCCCGTCTGCTGCGTCTG
GCCCCGCTTCTGCCGACAGACTCTTCAGGGGCTGAAATCA
AGAGCCGACTGTTGCGTATCGCAGAGGAGCTGAGCGAGAA
AACCCTGCTGTCTGCATCGCTCTCAGATCCTACCAAAGGT
CTGTTGTCTCCTCCGAACCCCTCAGACTTTGATGCCACCA
GCGTCCTGGGATTTCCATCTAGCGTGATCGCAGAGCAGCT
CACCAGGATTGAGACAGATCTGTTTCTGAAGCTGGTGCCC
CATCACTGCCTGGGCTCTCTGTGGTCTCAGAGAGATAAGA
AGGGTCAGGAAGGAGCATGTTGGTCAGTCAGAGCAACTAT
CAAGCAGTTTAATCGCTTAGCTAACGCCGTCACGGCCTCG
TGTCTGTGGATGACAACTCTGAAGAGCCAGCAGAGGGCCA
GACTGCTGGAGAAGTGGATCAGCGTTGCAGAGGCCTGCAG
AACCAGGAAGAACTTCTCATCGCTGTACGCCATCCTCTCA
GCGCTGCAGAGCAACCCCATTCACAGACTGAGGAAGACCT
GGCAGGAGACAGACAGAGAAGCTGTGAAGAGATACGAGGA
GCTTTCTGACATCTTCTCAGAGAAAGACAACTATTCTCAG
AGCCGAGAGCTGCTCAAAGAGGAGGGGACTTCCAAATTTG
CAAACCATGACACTAAAATCAACAACAGGAGATTTACTGG
GTCGTGCGCTCAAGGCACTGTACCATACCTGGGCATATTC
CTCAGAGATCTCACCATGCTGGACACTGCAGTCAAAGACA
GACTAGAGAATGGCTTCATCAACTTCGATAAACGACGACG
GGAGTTCGAAGTCATCGCTCAAATACGCCTCCTACAGTCC
TCATGTAAAAACAGCATTTTTCGAACCGACGAAACATTCA
TTCATTGGTATCACAGTGTGCCCACTCTACGTGAAGAGGA
AAGCTACAAGCTGTCCAATCAGATTGAAGCACCAGGTGAG
CCGAGTCCTGGCCGTGGCCTGAACCCTACAGTGATCATCA
CACAATGTCCAGACGCTCTCTCAGCTGTTGCCAATACGAC
AATGGATGCTGACGGCATATTTGACTTTCCATCTCCTGTC
AATCAGCTGCTCTCCAAGCTTTGCAAGCATGTGAAATCCC
CATCCGTTTCCTGTCTGGACGTTGATTCGTCACCGCCATC
CAATGATTCCACGCCCTCAATCCTGACCACACCCACTACA
GCTGTCAAATCACATCGCCGCTCTGTCTCCTGTGGCAACA
ACCCGACCAATAGCAAACCAGAGGCGGGGCCTGATATGAG
AATCGTCAGGATACGGATGGATTTGCACGACGGCAACTTA
TACCGCAGCATTCTGGTTACCAGTAATGATAAAACACCCA
CTGTAATCAGTTCTGCATTAGAGAAGCACAACCAGAACGC
TCAAGAAGCCTCCAAATATGAGCTGATCCAGCTGCTGCCT
GAGGGGAAAGAGTTAATAATACCTCCAACAGGAAACGTCT
TCTACGCCATGTCTTCAGCCAGTGTGGACTTCCTGTTGCG
GAGACGAGGAGGAAACACACCGACAGGTTCTCCAAATCTC
GGCAATGAAACCAGCGCGACCTTCCCTCGAATCAAAGCCA
AGGGCAGGAGACTAGTGCGCACGCTGTTTTAACACAAAAA
CAGGACATTCAAGGCCACAGAAAAGACATCAAATATGTCA
TTCAGAGCCCTGAGACAAAAACGGTGTACAATTGACCCAA
ATATAGTCCCAACATTAGTAATTTGAGTGAAAGCTTGGTT
TTAATGGCTCTAAGATGTTAGTTACTGCTAAATGTTGCAC
TATTTTTGCATTTCATAAATCCATAATGAATTTCAAGTAC
CTTTTAGCTGATGTCAGCATTTCCAGGACTCCCCCGTCTA
CCTCTAAAGCTGAAGTCCATTGGTTACAGATTATTGGTCA
CAGAACTGCATTAATAAGGCAAGACACTGCAGGTGAATAG
GGTCAAAAAATTAACATT

rgl2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rgl2-201 2458
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgl2-201 Contained in:
[BAC] DKEY-107O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026738 (1),  Ensembl_Trans:ENSDART00000004052 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF202722 (1) 1130 nt
GenBank:CK676040 (1) 395 nt
CITATIONS (2)