ZFIN ID: ZDB-TSCRIPT-141209-251
Transcript Name: slc27a6-201
Previous Name: slc27a6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047229 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047229|OTTDARG00000033574|ZDB-GENE-060825-27 slc27a6|OTTDARP00000037124 slc27a6-001 LG_none CT027815.11,CR790388.17 Danio rerio protein_coding KNOWN, 2173 bp
GTTTTATAACATCCATTGAAGAACTTACCCTGAGCCACTA
TAACAATGTCAACGGTTTGACAGCTTTAACCAGGTCTCTG
CGTGTTTATTTTTTCCAGAGATGTTGTCATGGATCGCGGC
ATTGCTGACAGGAATCCTCACCGCGCATCTCGCACAGCGC
CTGTGTTTTCCATACTTCTGGAAAGACGCTCTTTATTTAA
TGAAAGTCATACGATACGGAGCGCGTCTGGAAATTTACAA
AAGGACCTCACTGATCGTAACGATCGTAGACCGGTTTGTT
CAACAAGCACAGCGGTTTCCTGAAAAACCGTTTGTGATTT
TTGAAGGAGTGACGTACACTTATGGAGACCTCGAGGCGCG
CAGCAACAGGGTCGCGCGCTTGTTTCAAGACACGGTGAAA
AAAGGAGACACGGTCGCGCTCCTCATGAACAACGAGCCCG
ATTTCATCTCGGTCTGGTTCGGGTTCTGTAAACTGGGCTG
TGCTTTGGCGTTTCTCAACACAAACATCAAATCCAGGTCG
CTGCTACACTGTTTTAACTGCTGTGGGGCCAAACAACTGG
TGGTCGGAGCAGATCTTCTGGACAATTTAGAGGACATTCT
TCCCAGTCTCCAGGAGGACAATATCACAGTTTGGTCTTTG
GGTCATGGAAATTCTCATCCTGGGGTCCACAGCCTGCTAG
ATAAAATTGAGAAATCTTCACAGGAGCCAATTGCAGCTAA
GCGCAGGTCCATCTCCTGTCTCAAAACCCCCACTCTCTAC
ATCTTCACTTCAGGCACAACTGGGCTACCCAAAGCTGCAG
TCATCACTCATTTGCAGTCCCTGAAGGCAGCAGGTGGATT
TTGGGCATATGGCGGTACAGAAAAGGATGTAATCTATACC
CCACTTCCCTTGTATCACAGTGCTGCCTCACTTGTAGGCA
TTGGAGGGACCATTGAATTAGGTGCCACTTGTATTCTAAA
GAAGAAGTTTTCTGCCTCTCAGTTCTGGAATGACTGCAGG
AAATACAACGTCACCATTTTTCAGTACATAGGAGAGCTGT
GCCGATATCTGTGCAATCAGCCTATGGGTGAAAATGAGAA
GGATCACAAGGTGCACATGGGTGTTGGGAACGGACTCCGG
CAGGACGTATGGAGAGAATTCCTTCAGCGTTTCGGGGAGA
TCCGCATGTGTGAGATATATGGCTCTACTGAGGGAAACCT
GTGCTTCATGAACCATATTGGCAAAATTGGAGCGGTTGGA
CGTTCCAATTTCTTTTACAAGCTGATTTTTAAGTATGACC
TGGTGAAGTATGACCTGCTTAGAGATGAACCTGTGAGAGA
CCATAATGGATTCTGCCAACGTGTTCAAAAAGGTGAGACG
GGACTGCTGTTGTCTAAAATCTGCAGCCAGAGTCCATTTT
TTGGTTATGCGGGAAGCAAACAGCTGACTGAGAAGAAGAT
TCTGCGAGATGTGTTTGTCAAAGGAGATGCTTACTTCAAC
ACTGGTGACCTGATGGCTGAGGATGAGAACAACTTCATCA
GCTTCAAAGACAGAGTGGGGGACACTTTCAGATGGAAGGG
TGAAAATGTGGCGACCACTGAGGTGACAGAGATCTTAGGA
CTGGTAGATTTCATTCAGGAAGCCAGTGTGTATGGAGTTC
AGGTGCCAGGAAATGAGGGTCGTGCTGGAATGGCTGCAGT
GATTGTGAGACCTGAGTGCACATTCGATGGGAAGAAGCTC
TTCGATCTTGTTGTCAGAGAATTGCCCTCATATGCTCGAC
CTCTTTTCATAAGGCTGCAGGAATCTATAGAGACGACAAG
TACGTTCAAGCATCAGAAGTTTGGTTTGGTGGAGAGTGGC
TTCAATCCCTCCACCATTAGCGATCCGCTCTATTTCCTGG
ATTACACAGAGAAGAGCTACATTCCTCTGACCAGCTCCAT
CTATGCTAGCATATCAAACGGTCAGAAAAAAGTCTAGCCC
AAGCCTGTTTAAACCCCACGATACCTTAGAGGAACTGATT
GTCACTGCACTGATACTGAGAAACACGCTGGCTCATTTGT
AGCACTGTATATTTGATCAGCGTCTGCCGTGAATTATTGA
TCACAAATGTCTTTCAAGAGCTGCAGACCGTGTCGTTTAG
TGAATATAGAATTAGTAGAAATAAAAGAGGGTAAGGATGA
TCTCCTCCAAGTC

slc27a6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc27a6-201 2173
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc27a6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000047229 (1),  Ensembl_Trans:ENSDART00000121864 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC122420 (1) 1576 nt
GenBank:DV593382 (1) 796 nt
GenBank:FD487137 (1) 358 nt
GenBank:EB783749 (1) 326 nt
CITATIONS (2)