ZFIN ID: ZDB-TSCRIPT-141209-2442
Transcript Name: cdk17-201
Previous Name: cdk17-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000008196 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000008196|OTTDARG00000007275|ZDB-GENE-041210-15 cdk17|OTTDARP00000007230 cdk17-001 LG_ BX537336.19 Danio rerio protein_coding KNOWN, 2033 bp
CTCCGATGTCACCCCTAGGCGGAGGCGTCAGTAGACGGGC
AGCAGCGGCACCCCTCCCGGCCTCGAGCTCCGTCACCGTG
CGCTGCGCTACAGGGAAACGATCGCCATAGTGAACCGCAC
GCGAAGCACCTACGGACCCGTTAAACTGAGGATATCAGCG
CAAGTTTGGCCGATTTAAGTGGGGTGAGGCTGTGTGTTTT
TCGTCGGAAAGGCGACTTGTGTTTGTGTGTGTTGGCGGAG
AGTGGAAAAGACGGCATCCGGCCTCCGAGAAGCAGGCGAG
GGCAGGGACTCGCGACCGAACAACGTTTACCGTCTCTGGC
CCCCCCTGCCTCAGAGGCCCATGGAGAGGATGAAGAGGTT
TAAGAGACGTTTGTCGCTCACCCTGCGTGGTAGCCAGACG
ATCGACGAGTCTCTCTCGGAGCTGGCGGAACAGATGACCA
TTGAGGAGAACAGCAGCAAGGACAGCGAGCCGATTGTAAG
GAATGGCCGGCCGCCGTCGTCCCACAGCATGCACTCGTTT
TTGCACCAGTACACAGGCTCCTTTAAGAAGCCTCCTTTGC
GGCGACCGCACAGTGTCATCGGCGGCAGCCTGGGCTCCTT
CATGGCCATGCCTCGAAACGGCAGCCGTCTCGACATTGTT
CATGAGAATCTGAAGATGGGTTCGGATGGAGAGAGTGATC
AGGCCTCAGGAACGTCTTCAGATGAAGTGCAGTCTCCCAC
CGGAGTGTGTCTGCGCACCCGAAGCCACCGCCGCATTTCC
ATGGAGGATCTGAACAAACGCTTGTCTTTGCCTGCTGATA
TCCGGATTCCTGACGGCTACCTGGAAAAGCTACAGCTGAG
CAGTCCACCGTTTGATCAACCCCTCAGCCGACGCTCACGC
AGAGCCTCACTGTCTGAAATCGGCTTTGGGAAACTGGAGA
CTTATATCAAACTGGACAAGTTGGGAGAGGGCACGTATGC
CACCGTTTTCAAGGGGCGAAGCAAACTGACGGACAACCTG
GTGGCTCTGAAGGAGATCCGGCTGGAGCACGAGGAGGGAG
CGCCGTGCACCGCTATCAGAGAAGTGTCATTACTGAAGGA
CTTAAAGCACGCCAACATCGTCACGCTTCATGACATCGTC
CACACAGACAAATCACTCACGCTGGTGTTCGAGTACCTGG
ATAAAGATCTGAAGCAGTACATGGATGACTGTGGAAACAT
CATGAGCATGCACAACGTCAAGATTTTCCTCTTCCAGATC
CTGCGAGGTCTAGCGTACTGTCACAGACGAAAGGTTCTGC
ACAGAGACCTCAAACCACAGAACCTGCTCATCAACGAGAG
AGGAGAACTCAAACTGGCCGACTTCGGTCTGGCACGAGCC
AAGTCTGTTCCCACAAAGACGTACTCTAATGAAGTGGTGA
CCTTATGGTACAGACCTCCTGATGTGCTGCTGGGCTCCTC
TGAGTACTCCACGCAGATCGACATGTGGGGTGTTGGATGT
ATATTTTATGAAATGGCTGCAGGTCGGCCGCTTTTCCCAG
GATCCACTGTTGAAGATGAGCTGCATCTAATCTTCAGATT
ACTGGGCACACCCACAGAAGACAACTGGCCCGGCATCTCA
TCCATCGAGGAGTTCAAATCCTACAACTTCCCCAAATACA
AGCCGCAGCCCTTCATCAATCACGCACCCAGGTTGGACAC
TGAAGGGATCGAGCTCTTATTGTCTTTTCTAAGGTATGAG
TCCAAGAAGAGGATTTCTGCAGACGAATCCATGAAACACT
CCTACTTCAAGAGTCTGGGCATGAGGATTCACACACTGCC
AGAAAGCATATCTATATTCACACTGAAGGAGGTGCAGCTC
CAGCGAGATCCTGGTTACAGGAACTCCTCGTACCCAGAGA
CAGGAAACAGCAAGAACAGACGGCAGAGCATGCTGTTTTA
AAGCTGCGTTCCCTCTCACACACACACACAAACACACACA
CACACACACACACACACAGGCTGATGGCTGTGCAGTACAG
ACAGACAGACTCTCTTTAGTGTGTGCATGCGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk17-201 Contained in:
[BAC] CH211-172B12 (1)

Genome Resources: Vega_Trans:OTTDART00000008196 (1),  Ensembl_Trans:ENSDART00000103070 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055158 (1) 1826 nt
GenBank:CT695387 (1) 791 nt
GenBank:BM182774 (1) 702 nt
GenBank:EB775410 (1) 552 nt
CITATIONS (2)