ZFIN ID: ZDB-TSCRIPT-141209-2385
Transcript Name: rccd1-201
Previous Names: rccd1-001, ch73-340g20.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062069 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062069|OTTDARG00000042940|ZDB-GENE-030131-3552 rccd1|OTTDARP00000048531 CH73-340G20.4-001 LG_ CU184832.20 Danio rerio protein_coding KNOWN, 1452 bp
CAAAAGCAACTGACAGTTCTTTGTGTTGATCAAAGTAAGT
CAATGAGTTGGTTTGGCTTTGGGTTTAATGGTTTTGGTCA
GATCAGTCGGGCAGATGTGAGCGGACAGGTGAAGTGTAAA
GTGAACTCACCTGTGCTGATATCAGATGATGAGTGTAAAT
CTGGTGTGAACAGATCAGACCGCAGAATCAGAGCCTGCTG
GAGCTCCAGAGCTGATCTTCAGCAAACACAATCTGGCAGT
GGTGTGTATTTGTCAGGGTGTGTGTGTGGACCGTCAGCTC
AGGTGTGTGCGAGTCAGGGCTGCACAGACGCTCTCATCAG
CGAAACACACCTGACGCTCAGCTTCACAGACAGAGTGGAA
TTATGGGAAATAAAACCGCAGCAAAACCAGCTGGTGTGGA
AGAGGGAGCACGAGCTCTCAGAACACACTGCCGCTCTGCC
GCTGGTGTCCGGCGGCTTCGTCCAACACAAACCTCCTTTC
TTCCATCCTCTGAAACTGTGTGCTGTGAGTCTGGTGTTGG
GATCTGAACATGCACTGCTGCTGACTGCAGACGGGACGCT
CTATTCATGGGGGTCCGGAAGTCATGGTCAGCTGGGTCAC
GGCGTTCTGACTTCACTGGAGGATCCGCAGGCGGTGGAGG
CGCTGTGGGGCGTCCCGATCAAAGCAGTGGCTGCTGGGAA
CTGGCACTCGGCTGCCGTCAGCTCCGGTGGAGATCTGTAT
ATGTGGGGATGGAATGAGAGCGGGCAGCTCGGACTGCCAT
CTAGAGGCCTGGAGGAGGAAAAGCGCAGAGGAAACGGCAG
TGGAAATGATGACCAGCCCATAAATACAGATGGAAAGAGC
AGAACAGACGTGTTTATCTCCATTCAAGCATTCCCTGCGC
TAGTTGACATCGCTAACATGTCTGAGATTAGCCGGATTAG
CTGTGGATCCCGTCATACAGCGGCCGTCACCAGTGCTGGA
GATCTGTACACATGGGGATGGGGTCAGTATGGGCAGCTGG
GTCACGGCACTGAACACAGCACAGATGAGCCCACGCCGGT
GGATTATTTCTCCTCTCACAGTTTGAGTGTCAAAGATGTT
GTTTGTGGGTCGTGGAACACTTTTGTGTCCGTGGTGCCAA
AGGAAACATCCTCTGTCCTGACAGAAACACACCCGGGTTT
ATTAAATTAGGTACAAATATATATAAGATCCAACATACAG
GATAGAAAGTAGAGGTGAAAACTGCTTTCAAACATATAAA
CGGTAAAAATGCTTAACAAGAGAGTACATTCATAATTAGG
ACGCTACATTATTGGAGAGATTATTGAGGTGCAGGTGAAA
CATCCGGACCGGAAGCAGCAGCGGTGGAAACTTCACAACA
CGATCTTGAATGAACTGCAGAAAAAACATTGACAGTCAAT
GAGGATCTTTAGTGATTTTAGTCCGAATAAAGTTGTAGAT
TTTTGTGCAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rccd1-201 Contained in:
[BAC] CH211-112D9 (1)

Genome Resources: Vega_Trans:OTTDART00000062069 (1),  Ensembl_Trans:ENSDART00000104859 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133846 (1) 1557 nt
CITATIONS (2)