header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2344
Transcript Name: st6galnac-201
Previous Name: ottdart00000061944

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061944 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061944|OTTDARG00000042865|ZDB-GENE-050309-58 st6galnac|OTTDARP00000048444 st6galnac-001 LG_ CU459056.15 Danio rerio protein_coding KNOWN, 2533 bp
GTGTGTGTGTGAGTGTTGTTAAAGTAGGCAAACTGCTGCT
CGAATTCACCTCTCATCGCTTGACAGGAGTTTCTCTTCAG
ACATCCGGAGACTCCCACACGTGAAAGCTGGAGCTCAAAC
CGAACTAATTAACTGGCAGCGACCCCGTCACCCCTTCCCC
TCGAGGAGTGCCTTAAAACCCCGATTTCATCAAAACACTA
CTCCAACCCTTCCTCAGGAGAACGCTCATGTGCTTACAAG
GTGACCAGGCGTTCTGGGGAAGACTCAGCAACTGGTGCGC
GAGGAAAGTAGCACGATGACAGGCCCGCTACCCAAGAGGC
TTCTGCTATGGTTCATTGGGTTATTGGGCATTGCATTGCT
AGCATTAATTGTTGTGTGCGTGGCTATGCAGATCCAAGTG
CCATGGCAAGTCTTGACCCTCCAGAGCTTTACCATAAATC
ATTACAGGTTATTTCCGGTGAAGAATAACAACAGTTCTCC
GGGTTTTCAGCTTTCTACTGCAAATGAAGTGGAAACAAAT
GAAGTACTGGAGCAAAACTCAGTCCAGCAATCAGATGTTC
AGGATTCATCGGCATTAGACAACAATGCAAAGTCTGATCA
ACTAAATCCAAACGCAAACTTCATAAAGCCAGTGCCAAAA
ACTGAGGCAAAACCCTTCATACCAGACTTTTTTGGTGACC
AGTATGCCACAGATGACGTTCCTCTACAAACAAACTGTCC
CACAAGCGTTAGGAAGCTTTTGCCTCAGAGTCCGTTTGCT
GAGAAATTTTTGCACAGTATTCCAGTGCTTCAGTGGGCAA
AGCATTTCACCACAGAAGAGTATCAGCGCTTGAGTCACTA
TGCTGGAGCACACGGCTGGGGAAGTGTTGATGTTGAAGTG
TTAAAGAGCTCATTGAGAATTTTAAATACGACCGCAAACC
ACTTGATGTTTGATGACTGGGAGAGCAGAACGAATAAATC
TGAGTGCATCCGCTGTGCTGTGGTGGGAAATGGTGGAATA
TTGAATGGATCAAGAAAAGGCACGGAGATTGATGCACATG
ACTATGTGTTCAGGGTGAACGGTGCGGCTCTTAATGGATT
TGAGAAGGATGTGGGATCCCGCACATCATTCTACACATTT
TCAACCAACACTATGAGAAATTCCATGCGTAGCTATGCTG
GCGTAGGCTACAGTGGTCCACCCATATCCAAGGAGACCAG
GTACATATTCCTGCCAGACCATGACCGAGATTACATTCTC
ATGAAGGCAGCTTCTACTCATACAATAATTGAGAAAGGCC
CCGAGCGCAGCAATAAACCTCCTAAATATTTTGGTGAAGA
TGTGACAGTGGAGAAATTCAAAATCTATCACCCAGATTTC
ATCCGATACCTCAGAAACAGGTTTCTGCGTTCAAATCTTC
TAAACACAGGCGCAAAAAAAATTTACAGGCCGTCTACAGG
GGCAGTAATGCTTCTGGCTGCTATTCATACATGTGACCAG
GTTGATGCTTACGGGTTCATGACCCCTGACTACAATTTGT
ATTCAGACCACTACTATGACAAAGTGCGACATCCTGTGCA
TTTCTATGCCAACCATGACATGCGCATGGAAATGAAGCTG
TGGCAGAAGCTGCATGAAGCCGGACTAATGAAGCTCTTCA
TGCGCACGTGAGCACAAACAGATGGACGCTCTGACTTTTA
TTATGTCTATGAGTTTAGTTTATTTTACTGTCAGAACTCG
TCGATGTCGTTTGGAGGGAAAACCTGAAATTCTTCCCTCT
GTATTCAGCAGTTTTGCAGGTAAAATTCATGTATTATTGT
ACTACATAGAGAAGCTATGTAGTGAACGGCCTGGAGTGGA
TCTCTTTAAGGCAGAAAAAATGTGTCAAAGGGAGAGGCCT
TGAAGTGTGGTTAGAGTTTGGGAAGATGTGAATAACTCTC
GCATTCTTGGCTGTGATTTGTTCACAGATATTGAGTCATT
TCAGATCAAGGCCGCACTAAATGAATCGCTGTGTGTCTTT
GAATCACGAAGAAGGATTTTGTAATATGTGCCTTAAGCCT
TCACACACAGAAACAGTGAGTGTTTAAAACGCCATCGCAC
TAAATCAAAAACATTCAACCAAAGATTATATTTTGAATTG
GTTAATCATGTTCTTACAATATGCTGTGTGAGTGCAAACC
TTTTTATATGGCTCATTTATAGATGAGTCAAGAAGTTTTC
TATTTTTAAGAGGACTTTTTATACCTTAGACGATTACGTT
TACAGCTTAACCTTACTTGGAAGCTTTAAAGTGCAATATC
TTATTTTGTGTTGAAATCAAAATGTGAACTTCTTTGTGAT
TTATTTTTATTTGTGCTGTTAAGCTAAGCTTGGTCACTTG
ATGCTCTGTTTTGATTGTATTTAACATTTTATTTCACCAA
ATAATTTAACTTTCTGGTCAAATGAATGATTTCACTTTTA
TAAAAACGGTAAGGGATCATCAATAGAAATTGGAAATATG
ATCATAAAGCAGGGTGCATTTTCAAGCTGAAAATAAATCT
GAAATTGTCCTTC

st6galnac TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA st6galnac-201 2533
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
st6galnac-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061944 (1),  Ensembl_Trans:ENSDART00000130985 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AJ634459 (1) 1359 bp
GenBank:AJ705080 (1) 1232 bp
GenBank:CT619893 (1) 832 bp
GenBank:CT659052 (1) 776 bp
GenBank:CK713547 (1) 491 bp
CITATIONS (2)