Transcript

pdzph1-201

ID
ZDB-TSCRIPT-141209-2303
Name
pdzph1-201
Previous Names
  • pdzph1-001
  • ch211-161h15.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061819 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061819|OTTDARG00000042781|ZDB-GENE-090313-385 pdzph1|OTTDARP00000048343 CH211-161H15.1-001 LG_ CU896666.7 Danio rerio protein_coding PUTATIVE, 524 bp
CAGAATCACGTGTGGGTGGACGTCACTCGGCACAACTCAA
ATCTGCCCCCGCTGGCGGTCAAGAACCCAGAATGCCTTGG
TTTGCTCCATCAGCTGGACAGAAGCAAAGACTCATGGGTG
CAGTACTACTGCGTGCTGAAAGACGGATGCCTCTATTTCT
ACGTCAGTATTCGTTCAACATCCGCCATAGGAGGAATCTA
TCTACATGGATACACAGTGAAAGATCAGCCGCTGGGGTCC
AGAAGATCCACCATTGAGCTCAGGCCTCCGTCTGATGAGT
TTAAAGTCTTCTACCTCTGTGCCGAAAATGGAAACGAGAA
CAAACGATGGATCAGTGCTATTAAATCCTCTATAACAAAA
TGGCTGCCACTGCATCAAGCAATTCAAGACTACATGAGTC
GGCCAGCCGAGGAAACGAGAATGTGAACAAGACTGACCTC
GATTCTGCCAGCGTTGATGACATGATGGTGAAGATCCTAT
GCCTTACAGACAAATCATACTACTGCGTTTCAAATCAGCT
GGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations