ZFIN ID: ZDB-TSCRIPT-141209-2303
Transcript Name: pdzph1-201
Previous Names: pdzph1-001, ch211-161h15.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain:
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061819 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061819|OTTDARG00000042781|ZDB-GENE-090313-385 pdzph1|OTTDARP00000048343 CH211-161H15.1-001 LG_ CU896666.7 Danio rerio protein_coding PUTATIVE, 524 bp
CAGAATCACGTGTGGGTGGACGTCACTCGGCACAACTCAA
ATCTGCCCCCGCTGGCGGTCAAGAACCCAGAATGCCTTGG
TTTGCTCCATCAGCTGGACAGAAGCAAAGACTCATGGGTG
CAGTACTACTGCGTGCTGAAAGACGGATGCCTCTATTTCT
ACGTCAGTATTCGTTCAACATCCGCCATAGGAGGAATCTA
TCTACATGGATACACAGTGAAAGATCAGCCGCTGGGGTCC
AGAAGATCCACCATTGAGCTCAGGCCTCCGTCTGATGAGT
TTAAAGTCTTCTACCTCTGTGCCGAAAATGGAAACGAGAA
CAAACGATGGATCAGTGCTATTAAATCCTCTATAACAAAA
TGGCTGCCACTGCATCAAGCAATTCAAGACTACATGAGTC
GGCCAGCCGAGGAAACGAGAATGTGAACAAGACTGACCTC
GATTCTGCCAGCGTTGATGACATGATGGTGAAGATCCTAT
GCCTTACAGACAAATCATACTACTGCGTTTCAAATCAGCT
GGAC

pdzph1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pdzph1-201 524
SEGMENT (CLONE AND PROBE) RELATIONSHIPS

Genome Resources: Vega_Trans:OTTDART00000061819 (1),  Ensembl_Trans:ENSDART00000171426 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR930917 (1) 539 nt
CITATIONS (2)