Transcript

myo1ca-201

ID
ZDB-TSCRIPT-141209-2293
Name
myo1ca-201
Previous Names
  • myo1ca-001
  • ch211-69i14.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061788 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061788|OTTDARG00000042760|ZDB-GENE-070705-190 myo1ca|OTTDARP00000048320 CH211-69I14.4-001 LG_ AL935065.8 Danio rerio protein_coding NOVEL, 3823 bp
TACAGAGAGAGAGAGAGGGGAAGAGCTGTATTAGTGTGCA
GGAGTGGACCGTGAGCATGTTTAAATATGGATGTACGTGT
GCTTCAAAAGGTGACCAGATAGAAAACTTTGTAGTGTGCA
TGTGAAAAGATGCACATACAGACTCGTCAGACACACCCTT
AAGATTATTAGTGCAGAACAGGAGCGAGGGATTCCCCTCG
AGAGAGAGAAAGAGAGAGCGAGAGGAAAAAGGAAAGAAGG
ATGAAGTACCGCCGCAGGGAGGTTGGTGTAGAGGGTGGTG
TACGGTTAATGATGGAGAGCGCTCTGTCGGCCAGAGACCG
GGTCGGTGTTCAAGATTTCTTGCTCTTGGAGAACCACAAC
AGTGAAGCCGCTTTCATTGAAAACCTGCGCCGGCGGTACA
GAGAGGGCCTCATTTATACATATATTGGGTCGGTGCTGGT
GTCGGTGAATCCTTACAAGGAGTTGGAGATTTACTCTAAA
CAGAACATGGAGCGCCACAGAGGAGTGAACTTCTATGAGA
TCTCACCTCACATCTTTGCCCTTGCGGATAATTCCTACCG
TGCGCTGCGGACTGAGAGAAGAGATCAGTGTATTTTGATT
TCGGGAGAGAGTGGCGCTGGAAAGACTGAGGCGTCCAAAA
AAATCCTTCAGTACTACACACACATCTGTCCCACTCGTAA
CAACACACACACTATCAGAGAGAGACTGCTGCAGTCCAAC
CCAGTTCTGGAGGCTTTTGGGAATGCTAAAACTCTCCGGA
ATGACAACTCCAGTCGCTTCGGAAAATACATGGACATTCA
GTTTGACTATAAGGGGGCTCCAATTGGAGGTCACATTCTC
AACTACTTATTGGAGAAATCCCGTGTGGCCCATCAGAACC
ATGGTGAGAGAAACTTTCACATCTTCTATCAGCTGCTGGA
GGGAGGAGAGGACCTGCTTTTGAAAAGACTTGGTTTGGAC
AAAACCAACCCACAGCATTATCATTACCTCATTAAGGGTA
ATTGTCCACGTGTGAGCTCTATCAGTGATAAAAACGGATG
GAAAGTTGTGAGAAATGCTCTCACCATCATTGGTTTTGAG
GACGAGGAAATACAGGCTCTAATGGAGATTGTGGCCAGTG
TTTTACATCTGGGAAACACACAGTTTGGTGAGGATGAGGA
GGGAGAGACTCACATCACCACTGAAGCTCAACTGCAGTTT
CTGTCCCAACTGCTGGGTGTGGATGGCTCTGTCCTGAAAG
CAGCTCTTACTCACAAGAAAATAGTTGCCAAAGGGGAGGA
GATGATCAGTCCCTTGAGTTTAGAACAGGCTCTCTCTGCT
CGAGACTCTTTTGCCAAAGCCATATATGGTCGTGCCTTTA
CCTGGCTTGTCCAGAAGTTGAACCGATCACTGGCCTTTAA
GGATGAGATTTACTACTCCAGTAAATGTTCGTCTGTTATT
GGTTTGCTGGACATATATGGATTTGAGGTCTTCCAGCACA
ACAGTTTTGAGCAGTTTTGCATTAATTACTGCAATGAAAA
ACTGCAGCAGCTCTTTATTGAGCTCACACTGAAAAGTGAA
CAGGAGGAGTATGAGGCCGAAGGCGTTGTGTGGGAGAGAG
TGGAGTATTTCAACAACAAAATCATCTGTGACCTGGTGGA
GGAGAAACATAAAGGCATTATCGCTATTCTGGATGAGGAG
TGTTTAAGACGAGGAGATGCCAGTGACATCACCTTCCTAG
AGAAGCTGGAGGACACACTGGGTGGACACGCTCATTTCAT
CACTCACAAAATGGCCAATGGGAAGATCCGCAAGGCAATT
GGTCGGGAGGAGTTTAGACTGGTACACTATGCTGGAGAGG
TCAACTATAACGTCAATGGGTTTCTGGACAAAAACAATGA
CCTGCTATACAGGCACTTGAAGGAGGTGCTGTGTCAGTCC
ACCAATCACATTGTGAGTCAATGTTTCCATGCAGATGAGC
TGATGGACCAGAGAAGACCTGAAACGGCTGCCACTCAGTT
CAAGCTCAGTTTGGCTAAACTGATGGATATTCTGATGTCT
AAGGAACCATCATATGTTCGCTGTATAAAACCCAATGATG
GTAAACAGCCAGGTAGGTTTGATGAAGTTTTGGTCAGGCA
TCAGGTGAAGTATTTGGGTTTGATGGAGAATCTGAGAGTA
AGGAGAGCTGGATTTGCATATAGACGAAGCTATGAGGCGT
TCTTGGAGAGATATAAATCTTTGTGTCCGGACACTTGGCC
AAATTGGCATGGGAATCTCCCTGAGGGGGTTGCCACACTA
GTCAAACACCTCAACTACAAACCTGAAGAATTCAAACTGG
GCAGGTCCAAAATCTTCATCCGCTTCCCAAGGACTCTGTT
TATTACTGAGGATGCACTTGAGGCCCAGAAGCAAACTATC
GCCGTCACTCTGCAGAAATCTTGGAGAGGCTACAGAGAGA
GAGCCAATTACCATCGCATCCGTCATGCAGTAATTGTCAT
CCAGTCATGGTGGAGAGGCGTCAAAGGCCGTAGGAAAGCC
AAGCACCGTAGACAAGCTGCTGACACTATTCGCAACTTCA
TCAAAGGCTTCATCCTGCGCAATGAGCCTCGATGCCCTGA
TAATGAATATTTCCTGGATCATGTGCGATTCTCCTTCTTG
ATGAAAGTCAAAAGGAACTTGCCAAAAAGTGTGCTTGACA
AGAGTTGGCCAAAACCACCACCCTCACTAACAGAGGCATC
TGAGCACATTCACAGAATATGCATCCGCAACCTGGTCAAT
GACTATTGCAGAAGAATCCAGCCAGAGTGGAGGAAGCAGC
TGGAACAGAAGGTTGTAGCCAGCGGGATCTTTAAAGGGCA
GAAGGATGGCTACTCTCGAAGTGTGCCCAAACTCTTTGTG
GCCACCAGGCTAGAAGCTGAAGAGATCAATCTCAAAGTGC
TGCAAACTCTTGGGAGTGACAACAAGGTGAAGTATGGGAT
AGCGGTCACCAAGTACGATCGACATGGTTTTCGCCCACGT
GTGCGGCAGCTGCTGTTGACCACTTCATCTGCTGTGCTGG
TCCAGGAAGCAAAAATCAAACAACGTATCGACTACGGTGC
ATTGCTGGGTATCTCTGTTAGTTCTCTCAGTGATGGATTT
TTTGTTCTGCATATTCCCACTGCTGACAGTAAGCAGAAGG
GTGACCTGGTGCTGCAGTGTGATCATGTGATTGAGGCTGT
CACCAAGCTGGCTATCATGGCAGACAAAATACACAATGTC
AACATCAGCCAGGACAGTATCAGGTTTGCGATAGCAAGGG
GAAAGGAGGGAGTGATCGATTTCACAAGTGGTTCAGACCT
CCGAGTGGTCAAGTCTAAGAATGGGCACCTGTCTGTGACC
ACGCCACGGATCTCATGAATCAATGACAGCTCACCGGCAG
CGGAAGGATCATTTTAAAGGAGTGCTTTAGCCAATCACTA
CACAGAGCCAGACTACACTTTTTATGATTTATTTCATTCT
CACTCCAAAGCACATATTAGCAATTGTATATGAACAGACA
TTTTAATCACTTTTTTGAATACCAAATTCAGACATTTTAA
TGAAGGTTTTGTTTGATGGGTTCAATTTATAATTTCTCTC
ATCTGAACAAACAAATTATTCTTTGCTATTTTAGTTGTTT
GTGATTCAAGCTTTACTAAGCAGTTATACTACAGAGTATT
TGTGAAATTTTAGACTAGATAATCTTTTACATTTTAAACA
ACAGTAACAGATGTTGTTTTTTACAGATAACACCACTACC
TATCAACACAGACTTTTTAAACTCATTTATTGTTGAATAA
AATGAAAAAAGCAATGGTTAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations