ZFIN ID: ZDB-TSCRIPT-141209-2276
Transcript Name: si:ch73-281k2.5-002
Previous Name: ch73-281k2.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061736 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061736|OTTDARG00000042730|ZDB-GENE-141222-10 si:ch73-281k2.5|no_translation CH73-281K2.5-002 LG_ CT573380.7 Danio rerio protein_coding NOVEL, 869 bp
GTTGTGTGTGCGAGTTTTTTGCTGATTCCAATTGTCACTT
CCTACAAATGTAGTTTCACAGGAAAGATCAAGTACACAGT
CTTTTAATGGTCAACGGCACTTGTTACATGCACGCATAGG
CTAATATTTGTCTACAAGTTCTTAAGCATTACCTGATTTT
TTTTCTTTTTTAATATGGACCATTTTCTCAATGCATCTTC
AGAAAAATTCATCCTCCTTTTTATTTTCTGCTTGACAATG
TCATATGAAACAAATTGCGAGGTGAACATTGATGATTGTC
TGAATCACCGCTGTCAGAATGGAGCCACATGCATAGATGG
AGTGAACACCTACACTTGCCAGTGCCCACCTAAATGGACA
GGTAAAAAAATAACTTAATCTTCTGTGTGGTTCTTGAATC
TGATTGGCTGATAGTCAAGAGATATTCTCCAAATAATAGC
ACTCCTACAGCTTCTTCACCGTTCACCCTTGTGTATTACT
CCACATACAGCATAAGCAGAGGACACTACAATTTGATAAA
TATTGCTTCTGTTGGACAACATAATTTACTTTTGAGGCTT
TTTTTTAGCTGAGAATAGTTGTTTAGATTGCAACTATGCA
ATTTATTTATTAGGATAGTGACTATTTTAAAAAATGTAAA
ATTTTTGAGCTTCGAATCCAGTGCATCAGCCTGTTTGAGC
TGACCAAAGAAAGTGACGGTTGACATTACAAGATGTCTAC
AGAGAGCGCATAAAAAGTCCTTAGAGGAGAACAACAGCAT
TTTCTCAGCGTATGTTTCAAACTACAGCTGAACAAATCGT
TATAAATCAGGTAAGTGACATTCTAATATCTCTCTGTTTT
GTAGTGCTGTTTTTGTACCACAGAAACTG

si:ch73-281k2.5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch73-281k2.5-203 (1)    Ensembl 1408
ncRNA si:ch73-281k2.5-002 869
si:ch73-281k2.5-003 (1)    Ensembl 1138
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-281k2.5-002 Contained in:
[BAC] CH211-183C17 (1)

Genome Resources: Vega_Trans:OTTDART00000061736 (1),  Ensembl_Trans:ENSDART00000159806 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH504522 (1) 897 nt
CITATIONS (2)