ZFIN ID: ZDB-TSCRIPT-141209-2261
Transcript Name: zgc:113295-202
Previous Names: ch211-151l1.3-001, zgc:113295-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061691 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061691|OTTDARG00000042695|ZDB-GENE-141215-41 si:ch211-151l1.3|OTTDARP00000048250 CH211-151L1.3-001 LG_ CU138531.25 Danio rerio protein_coding NOVEL, 1636 bp
TTCCTGCCTACATCCAGCAACTTTGCAAAGCCATTAAAGA
GTTGTGGACCAACATTCCACAGGCTACAATCAACATCCTG
ATCAGCTCTATGCAAATGTGTTGCACCGTGTGAGGCCAAT
GGTGGTCATACCAGATACTGAATGGGTTTCTGAAGCTCCT
CCTCCTTCAATGAGGCTCCTCCTCCTCCTCCTTCAGGTAT
AAATACTGTAATTTTCCCATCAGCCCACCAGTGAAGACGA
GCATCAGACCGTCAGCAAGAAGTGAAATCTGCAAGGACAG
AACATGAGTGATCCAGAACCCTGCAGAATTAAAGATGAAG
ATACTGAAGAGTCAGTAGACCCAATTGATGGAAATGGGGA
GACTGAAGAGGGTAATGATGTTAAAGCTGGGAAAATAGCT
CCTTTAAAGACATGTGGTGTTTTTACTGTGAAAAACGGAG
ACAAAAATCCTTTCACTTGCACAAGGTGTGCACAGATTTT
GGGAAACAAAAAGAGTCTAGAGATTCACATGAGGATACAC
ACTGGGGAGATACCGTTCACGTGTACTCGGTGTGGGAGGG
GTTTCTACCAATTATCAAACCTTAACAAACACATGACGAT
CCACACTGGAGAGAAACCGTACACATGCACTCATTGTGGG
AGGGGTTTCTACCAACCATCACTCCTTAATAGACACATGA
GGGTCCACACCGGAGAGAAACCGTTCACATGTACTCAGTG
TGGGAAGAGTTTCAACCAAGCCACACAGCTTAAACAACAC
ATGATGAACCACACCGGAGAGAAACCGTTCACATGCACTC
AGTGTGGGACGAGTTTCACCCAATCATCAGCCCTTAATAA
ACACATGAGGATCCACACTGGAGAGAAACCGTACACATGC
ACTCAGTGTGGGACTAGTTTCGGAGCCTCATCATCTCTTA
GTAGACACATGTTGATCCACACCGGAGAGAAAACGCACAA
ATGTGATCACTGCAGCAAGACATTTCTGAGTGCTTCACAT
CTGAAGGTTCATCTTGCAGTTCATAGAAGCGAGAAGCCTT
ATTCATGTCCTGTGTGTGAAAAGAGTTTTACATTGAAGTG
CATATTAAAAAGGCATCAGAAGATCCACACTGGTGTGAGA
GAGCATCTGTGCTTTAAGTGTGTGAAGACCTTCATGTCAG
CTGCAGAACTGAAACAGCACGAGAGGATTCACACTGGAGA
GAAACCTTTCAAGTGTTCACACTGCGACAAGAGATTTAGG
CAGTCAGGATCCCTGAAAACACATGAGAGGATTCACACTG
GAGAGAAACCGTACAAGTGTTCACACTGCGACAAAAGATT
CAGTCAATCTGAAAGTCTGAAAAGACATGAGCGGATTCAC
ACTGGAGAGAAATCGTACACGTGATCGGTGTCTACAGAGT
TTCAGACAGTCAGAGCAGCGTCCACACTGGAGAAACGCTG
CACACATGACATCAATGCAGCAAAGTGGTCTCTTGTGTTA
AGAGAGTCTCACTCTGAACATCAGAAAATGCTGCTGTGAG
AGATTGAGTGTAGAAAGTGTCCATTGAGTCTTGAATATTT
GCTTTTATTAGGGCGCACTGGGTAGCAAGGTTATAATAGT
TTGGGATTTTTCATTAGTTTCAGTTTCTATTTTGTT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113295-202 Contained in:
[BAC] CH211-151L1 (1)

Genome Resources: Vega_Trans:OTTDART00000061691 (1),  Ensembl_Trans:ENSDART00000168153 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091553 (1) 1698 nt
CITATIONS (2)