ZFIN ID: ZDB-TSCRIPT-141209-2258
Transcript Name: cbx8a-201
Previous Name: ottdart00000061680

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061680 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061680|OTTDARG00000042686|ZDB-GENE-040405-1 cbx8a|OTTDARP00000048242 cbx8a-001 LG_ CU467853.5 Danio rerio protein_coding KNOWN, 2763 bp
ATTCAGGCAGAGGCTGAGAGGGGAAAAAATAGCTGCGAGG
TTGAAGTAAACATGGAGCTCTCTGCCGTCGGGGAGCGGGT
CTTCGCCGCTGAATCCATCATTAAACGGCGCATAAGGAGA
GGGCGGATGGAGTATCTGGTCAAATGGAAAGGCTGGTCTC
AAAAATACAGCACCTGGGAGCCAGAGGAGAATATTCTGGA
TGAGCGTCTTTTCGCTGCTTTTGAAGAAAGGGAGCGTGAG
AGGGAGATGTATGGGCCAAAAAAGAGAGGACCTAAACCAG
AAACGTTTCTAATGAAGGCAAAAGCTAAAGCAAAAAGCAA
AACCTATGAGTTTGGACGAGAGATGTCCAGAGATATACGT
GTGTCTTTTCCAGTAGCAGAACCTGTTGTGACACCCAGAG
CACGTGAGGGACTGCGGACAGTTGTGCCAACAATCTTTCC
ACCTAGCACCATTAACAGAGGTGAAAGTGTTCGTGTGCGT
CCACCAGACTCTGAAAGAGACACCCTGACACATGGCACTT
CAATCCAGTGCCCACTTGATTTTGCCAACTCACCAAAAAA
GCGAGGACCAAAGCCAAAAATGCATCCAGCTGGAGGGTCA
TCCTCTGAAGGCATTAAAAGAAAGGCAGATGAATCGTTAT
CTTACCGCCCTTCCAAAACCGAGAGATCAGGAGAGACCTC
TAACTGTGATATCATGCATTTTACCCAGAAATACAAAGCA
GAAACCACCCATGATGGGAAGCAAATGGGAAGCAGATCCA
GTGATGTGAAATTTTCACATGGTGGAAGCTTCTTAAAAGC
TGGGCTAGGCATTTTGGGACATCGACAAAAGGTTGGCTCT
GGTGGTGCCATAAACCAACAAGCCAAGATGAAGCATCCTC
CCAAAAACAATCTATTTCGATCCACTGATCAAACCAGAGA
GCAGCTCTCTCTGAGCTTTGTAGATGATACAGACCAGTCC
TGGCTGCCTTGTTTGAAGAATATGGAGAAAATTGTTGTTA
CTGATGTAACAAGTAACTCATTGACTGTAACCATAAAAGA
GAGTTCAACAGACAAAGGGTTCTTTAAAGAAAACAGATGA
TGAGATAGTTTATGTATGTATGATGATATATTGTAATCAA
AGTAGAAAAAAAAACTTACATTTCTATATCATTTCTAGTC
TATAAAGTCTTTCAATCGTGTATATAATGCAAAAATATAT
ATAGTATATGTTTAGCCTACATTTCCATTCACGTTTTCTA
TGAAAATGAAGTTTATTTTTCTATTTCCCCAGATTTTTAT
GTAACTTTACCCCTTTTGGTTGCCTTGGTCAGCTTTATTA
TGAATGTAGGGCATAGAAGCTGTTAACATATACTAACGTT
TCAACGTAATGCACCTTTTAAAGGGACATATTGTTTAGTC
CCTTTTTATGAACTTATTTTTTCCGGATAGATTTTGTACA
TACTTGAAGGTCCAAACGGTAGTCTCTATTAAAGCACACC
CTTTAAAAGGCATGAAGGGAAATAAGCTACATGCATTCAT
AAACTTGTTTTAGGCCTAAAAATTTCCGCTTCAGAATCAT
TTTTCGTTTTTCTGCTCAATATATGACTTACGATATCTTT
TCCCCTCTTTAAAAACTACACAGGTATTTGATTGGTACGA
ATTGATTTCAAGTCGCTCAAGTAGCAACTCGTAGACAACA
ATTAAATCGTATTAATATAATTAAAACGACATTATATTAA
CCCGGAATTAACGGTTCGGCTTTTGCAGAGGGGAAGAAAA
CAAAGAAAATGTTCAAATGTAATTGGTTATTTAGTGCATT
ATTGATTTCATCCAATTCTTCGCTAATTTTACGTTTTTTT
CCGTATATTCAGTTTCTATCCAGTCTTATGTTAGCCTAAT
CGAATTAATAAACCATACGTCGATGTTTTTATTACAGACC
CAGTTACTGTAAACGATTAAACATAAAAAAATAAACCTAT
ATATCATATATAGCTTAATCTCAAAAGCATGCCGACCTTC
TTGGGTGAAGTAGATCATTAAGATCTGATGTCTTTCAAAA
ATTGGGGTGAACAATCTGCGAATGATCCAACCATTCGTCC
AAAGATATTCACTCGGTTTCAGGCTTATTTTTAATTACCT
ACCGTGTACTGTAAATCTATAAAATTAATTACTATTATTA
TTATTATAGCTGCAAAATTTATTCGTATTTTTATGATTTA
ACAATTATAAAAAAGCCACCGCAATCCCACACTGTCGGAA
ACAGAAACCACTGTAAGGGGATAAACGTAAGTTTTCATTT
TTAATAATCTATAGGGGAAGAAATTATTTCTGGAATAAAT
CATGGCTGTTGACTAAACAATATGAACATTATTTTAATAA
CACATAGAAACACAAAACGTTTTCCTAATCACGGTGGTTT
CAAATTAAAATTGATATCAAAATTACATTTCTGTAGATTT
ATTAACAAAAGCGCTTGTTGAAGAAGTTCAGTCCACAAGA
TGTCGCCATGAACTTGATATAGCAAATCCGTGTATACTTT
TAAAAACCCGTTAATACCATCTACGGCTTATGTACTGTGA
TCTTTGCTTTAAAGTTAAAATGTAAATGTTTAAAACGCAT
TTAGGCCTATAAATAGCAGTCACAGATGTTCAATGTGTCA
AATGTTTTTGTGTTTGTATACTGTATGTTTTCATTGGTTT
ATTGATTTTGGACTGTCTTGTGTTTTATGATTCAGATGTA
AAAAAAACAGTCAATATAACACTGAAATAAATGTGAGAAC
AAT

cbx8a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cbx8a-201 2763
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbx8a-201 Contained in:
[BAC] CH73-161I8 (1)

Genome Resources: Vega_Trans:OTTDART00000061680 (1),  Ensembl_Trans:ENSDART00000124329 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC125904 (1) 2808 bp
GenBank:AY398319 (1) 1444 bp
GenBank:AY179330 (1) 1151 bp
CITATIONS (2)