ZFIN ID: ZDB-TSCRIPT-141209-2242
Transcript Name: dnajc7-204
Previous Name: ottdart00000061628

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061628 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061628|OTTDARG00000042651|ZDB-GENE-040426-2483 dnajc7|OTTDARP00000048200 dnajc7-003 LG_ BX901973.12 Danio rerio protein_coding KNOWN, 751 bp
CAGAGATGGACTTAACCAGCGACGAGGAGTTAGAGAGGGA
AGCTGAAGGTTTCAAAGAACAGGGAAACGCATACTATGTC
AAAAAGGACTATGCTGAAGCTTTCAACTTTTACACCAAGG
CCATCGACCTCTGCCCAAAAAATGCCAGTTACTATGGCAA
CCGTGCAGCCACATTGATGATGCTGAGTCGCTACAGAGAG
GCACTAGAGGATTCTCAGCAGGCCGTGCGACTAGATGATA
GCTTCATGAAGGGACACATGCGTGAGGGCAAGTGCCACCT
GCTGCTTGGCAATGCAATGGCCGCCATCCGCTGCTTACAG
AAAGTTTTAGAGCGGGAACCAGACAACAGCCAGGCCCAAC
AGGAGATGAAGAATGCAGAATCCATCCTGGAGTACGAGCG
CATGGCGGAGATCAGCTTCGAGAAGAGAGACTTCCGGATG
GTGGCACTGGTGTGTGTAGCAGTCTGGAGTACAGATGAAC
ATCAGCGTGTGTCTGTCTGCAGGTGGTGTTCTGTATGGAT
CGGGTATTGGATTCTGCGTCTGCATGCCACCGGTTCAAGG
TGCTGAAAGCAGAGTGTTTGGCTTTGCTGGGGAGATACCC
AGAGGCCCAATCAGTTGCTAGTGACATTTTGCGGATGGAC
TCCACAAATGGCGATGCGCTGTATGTCCGGGGTTTATGTC
TATACTATGAAGACTGCATCGATAAGGCTGTGCAGTTTTT
CGTTCAGGCGCTGCGCATGGCACCTGACCAC

dnajc7 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript dnajc7-204 751
mRNA dnajc7-201 (1)    Ensembl 3227
dnajc7-202 (1)    Ensembl 511
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc7-204 Contained in:
[BAC] DKEY-26L17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000061628 (1),  Ensembl_Trans:ENSDART00000167953 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT626705 (1) 753 nt
CITATIONS (2)