Transcript

maml1-201

ID
ZDB-TSCRIPT-141209-2235
Name
maml1-201
Previous Names
  • maml1-001
  • ch211-121b13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061607 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061607|OTTDARG00000042644|ZDB-GENE-100820-2 maml1|OTTDARP00000048182 CH211-121B13.1-001 LG_ BX530081.6 Danio rerio protein_coding PUTATIVE, 5478 bp
ATGGCGGATTTTGTGGTGCCGCGGCATAGTGCCGTCATGG
AACGCTTGCGGCGGCGGATTGAGCTTTTCCGGCGGCATCA
CACCGGCTGCGAGAACCGCTATGATAACACGGCTATGGAG
CGGCTGGAGATGGAGAGGCAGCAGACCATCGCGCTGCAGC
AGCGCTTCCTGCAGACCAAGGCCAAGCGCTCCAACAAACA
CAGGCAGCCGCCGGCGGCAGCAGCGGCGAGCGCGGACCCG
GTCGGGCAGAGGGGGGCGAGCGGCGGGGGCGGCAGCGCGG
AGATAGCGGACGGAGGGAGTGGGACGCCCGGCGAGCAGAG
CAGGAACAGCACGCTGATTGCGTTACAGGAGACTGTGAAG
AGGAAGTTGGAGAGTGCTGAATCACCTTTAGGCCGTGACC
AGGTGAATGGTTTCACCGATGGCTACCCCCCTAATAAAAA
GTCCTGTGTTGAAGATGCAATGGGTGGTCTTAATGGGGTC
TCAAATGGTGTTGTGCCTCCTCTCTCACCCTTGGACACCA
AACATAATGTGAACACTGATGCCATGATGGCCAATGGGAA
CCACAGAGTGGTCGGTTCCGAGCACAACGGAGCAAGTTTA
AAAGACAATGGTGCAGTGCGTGGTTCAGAGTCTGATTTCC
GTCTGAAAGAACCAAAGCAGGAGCCGGTAGATGATGCCTT
GTCCTGCATACTTCCCCAGGGAGGAGCAAATGGAAACAAC
AGCCTCTTCCCTGACCTTAACCTGAATGATCAGGACTGGA
GTGAGATCATGGAGGAGTTCAATCGCTCTGTACCCTACGA
GGACATCCAGGAGCTCTTCAGCGTTAGTTTTGGAGATCGC
AAAGACCCAGAGCTCACATCTGCTGCAGCTCAGAGCTTGA
TATCACAAGATCTGCCTAACGTGAAGACTGAAATTTCTCC
TGCCACGGCTACCTCTGCCTTTGAGCAGGACTCCTGCAAT
GGTTCACCTCAGATGAGACCGACTTCATCGGGACCTCCGC
TTCACACCAACTCTCCTGTTACGGCTCCGGCCACTTCACC
AGCCCTGCCTGTTCCACAGCATTCGCAACAGGGGTCTATT
CAGAGCAGAGCACTCCCAAATCACTTGATGCCCGTTCCAC
CCAAAGACCTGTCCCCTGCTCAGCAGCTGCAGCAGTTGGC
TCAGCAGAGAGCGATTTTACACAGTCAGCAGCATGTAGTT
CAAAAGCCACCACAACAGAAACCTCCACAACAGCAACCAA
CAAAGTTCCACCAACAGCCCAGCCACTCTACATCTTGGCC
CCAAAATGCTCCCACCCAAAGTCAAATGGGTGGTACGTTT
GGGCTTGAGAAGCCCACCAGTCCTTCTTTGTACCCTCAAG
ACTTTCCCAATCCCAAGACCCTACTCATGCCAAACAAAGG
TTCTCCCAAAGCGGGTGCTCCAGCTGGCTACATGCAGCCT
GGTGGCCATGCCAACATGTTAAGTCACCCAGCAGCACCCA
CAGGGCCCCTCGGCCATCCTTCCAACCCAGGTGCCCAGGC
AGCCATGTTGGACTTCAACAACACTAAACCACTGTCTCAC
TATGACGACGGACCACCAGGGGCACCCAGGGGCCCTCCGA
CCACACAGAACCACAACAAACCGAACCAGGCCATCCTAAA
CATGATGCGACAGCAACAGATCCAGAAACAAAGGGCGCCT
ACCATGAACTTCAGACCAGCACATCTACCACATACTGCGG
ATTCAGGCTCCTACCCTCCTAACACGCACGTTCCCGGTCC
CAGCAACACCATGACCCCACAAACAAGCAGCAACAGCATC
CCGGGTCACCATAATAATCCTGCCTACTTGAAGCAGCAGC
AAATTCAGCTGATGAATCAACAGAAACAGTTTCAGCTCCA
GAGACAGATCATGGTTGAGCAGGTGCTTTTTTTCTTACCC
TTTATCATTTTGGAGAAGCAGCGGCAGCAGCAGGAACAGC
AGCTGCAGAGACATTTGACCCGTCCACCACCTCAGTACCA
GGACCAACAGAACCCGCAGGCCCAGCAGAACCCTTTCCAG
CAGCAACAGCAGCAGGTCTCCCAGTTCACCAGTGTGCCGC
CCTGCCTGGCCCAGCAGCACACCTCCAATTTCAGCGAACA
CACCATCTCTGGTGCATCTCAACCAATAGGAAATGTAAAC
ACTCTCAGTGGCCCCGCTCCTGGAACACAGCGAATGTTCT
CTCAGACTCAAGGCATGATGGGAATAGGAGTTGGCCAAAA
TGCTGGTCCAAATACTGGTCCCTCTACGGCTGCCAGTCAA
GCAGACATGAGCCTCCCACCCTGCAGCAATCTTGATGTGC
AACAAGTCCTCTATGGGAACATCTCTATGCATGCCTCCCA
TGCCAACCAGCAGAGACAACCAGTGTCCACAATGTCTGCT
GCTTACCGGCAGAATGTTCTAGCAGCCCAGCAACAAGCAC
ACTTGAAAAACCAGCCCAATGCTGCCTTGTTGAAACAACA
ACAGCAGCAGCTGGCACGTCTGCCCAACAACATGGCGAAC
GCAATGTCTAATAACATGGGATCTGCTATGCCCACCTCCA
TGCCTACCAGTATCCCAGGTGCCTTGCCTGTCCAGGCTCA
GTCTTGGCAGCAGCAGCCACCCCAGCAGCATCCAGCTCTC
CAATCTGGCTCTGCGAATGGAGCCATGCCAGCTGGTTTCC
CCAATTCCAGCTTTCACATGCAGTCAAGGTTGACTAAACT
TCCCAACAACACCCCATTTCCCCAAGGGGGCATGGGGAAC
AGTGCGGCAGGTAGAACCATGGGAGGTATGAATCCTGGAC
AAATGATGACTAACATGAACCAGCAACGGACAAATAACCC
AGGCATGCCCCAGCAGCTGCCACCTCCAGTCCAGCAGACA
GCCCAGCAGGGTCAGCCACAAGCACCACCGCAAACCCAGC
AGGTTTTGCCTGACTTGGGGCCCTTTAGCCAAGCACAGGC
CGTACCCAACCGCACCACAGGACTTCAGTGCAATCAGGCC
TACCAGCTCAACAGGGCGGCCAATCAGCAGCTCCAGTTCA
GCTACAACACCCAATCGGGAGGCAGCTTGTCTGGGTTTCC
AGCCGAGACTGATTTAGTGGATTCTCTGTTGAAGGATCAG
TCGACACAACAGTGGATGGACGATATAGATGAGCTTTTGG
CCAGTCACCAATGAGTGACACCAAAGCTAGTGCCTTCGAT
AGACAAGATAGCGTGAAGATCCAGATTTTGGATGATTTGT
GAGATGGTGAACCTGCTTGCATCACATGGTCAGATCTGCT
GTGTTCTCTTTTGAATATATCTATATATATATATAATGGT
GTATATAATGGAAGTCAAGTAGAGCACAGAGCCTGCCTCA
CAGAAGTGTTCTCTGGACTTAAAATTTCAAAGAGGGAAAT
GCTCTACTACTGAACCTGTGGCTCAGTAAAACCACTGAAT
TTTCCTATATAATGAGTTTGTGCTCATGAATGCGTTCAGC
TGTTCGTCCAGTTGGGTTGCCTTTGTGTTCACTGTAGGCA
TGAAGAGGCTATGTTCAGTATCAGGAAGGTCTTGACACTT
CCGCATGCCTTATAATTGCACTCCTGAAGAGGCACAAAAT
GATTTACAATTTAAAGCAATAGTTCTCAAATAGTGCTCAA
ACGGTTCAAACCCATATCATTTTATTTTCTTCTTTCTTTC
ATAGGGTGACCAGTTCGTGAGGGCAAACCTTCAGCAGTGT
TTAGCTTCAAACCAAACTAAACATCAGTCTTGAGCCCATT
GAATCATTCTCAGTATTGCACAGCCATTCCTTGAATGGGA
ATAAAGGAGTAACAGTCAGGTCCAGAAATATTGGTACCTC
GACACAGTTCTAACATTTTTGGCTCTATACATTAACACAA
AAGATTTGAAATGAAACAATCAAGATGTGCTATAATTTGA
GGGTATTTTTTTCCAAATCTGGTGAACGGTGTAGGAATTA
CAACAGTTTGAACTCTGGACCTTTTACCTGCTCATTGTAT
TTGGAATTATGAGGGAATAACACACCTGGCCACGGAACAG
CTGGAAAGCCAATTGTCCCATTACTTTTGGTCCCTTAACA
AGTGGGAGGCACATATGCAAACTGTTGTAGTTCCTACAGC
GTTCAAATGATTTGGATCCAAATAACCTCAAATTAAAGCT
GACAGTCTGCAGTTAGAGCACATCTTGGCCATCATTTCAA
ATCTATTGTGTTGGTGTATAGAGCCAAAAATGTTAGAATT
GTTTTGATGTCCCAATATTTTGGACCTGACTCTGTGTAAA
CTGAATCTTAGGCCCAATCCCAACTCTACCTCTTAGCCCT
TTCCCTTACCCCTACCCCTCGTTTTTTTGCATTCACATGA
AGGGTTAGGGGTGTCCTAATTCTCTTTAGCTTGAAGGCAT
AGTGCTAAGGGGAAGGGCAAGATGACCCTTAAAGTGAAGA
TTTTCCAGGACCAAACTAGAAACTCTTGAGTATAGAAATT
TTCCAGAGTACACCAGCTACAACGACAAAATGGCTGCAGA
TGCACAGTAAGGAGACTTTTACAACAACCAAGCATATGTT
TTATTATATTAGTGTTTTACAATCATGCTTGTCCCATTAC
TTTGCGGTAAATTTGAAGCCCTTCCTTTTACATTTTGTTT
CAAGGGCCAAGGGGAAGGCGTATGGGGTAAAAAACAAACA
ATTGGGATTGGGCCTTACTTGTCGCAATATTGTTCATGAC
TTCTAAAAGTGATGATTATGTACTAAACTGCTCTTCACAA
AAGCAGTTTATTCAGCGTACTGAAGCTTCATTAACATTCT
TTGATAAACAAATGTGGAAAGCGGCGTCCAGAGCAGGATC
TGACACCCCTGCTTTTATAGGACACAGTAGGAGATGTTTA
TCACAAATCTGACACCATTTGTATGAGCATTGTCTCATTT
TAAAAAAGAAAGTTAAATGAGTTTGCAACAAGAATTGCCA
AAAAAGTGATTCTTTGAGTTTCACGTGGTTTGTAGTCATT
GGATAATTTCACATTAATCTTGTAAGGTAGATGTTTGTTT
TAATCAGATTATCACAGGAATAGAAAGATCTGATGAACTC
TTCAGTGAACATGGGGATGCATATGTTACACTACGTTTTT
CCTTCTTTCTCTCGCTCTCTGGAACTGAACTAGTAAGCCC
AGAGTTCTAGATTTCCATGTTGGTGAGAGGGTTAATATTC
CTGCTTTTCTCCCTCTGGTGCCTGATGATGTTACATGAAG
GCAGGTCAGGTGCTGGTCTGAACTGTGTCGCCTGAACTCT
TGCTTCATCTGAGATTCTGTGACAGGATTTCATGTATATT
TATATATTTTTTGTATGTATGCAGTTTCTATTGTTCTGAA
GAAGATAGATCTTATTTTTATATGTACATTGTTGCAAATT
TTTGTAAGTATTTTATACTTTTATTATTGTTCTCTGAAAA
ACAAGAGTATAGTGTAAATATAGTTCTCTAGAAATGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations