Transcript

hpn-201

ID
ZDB-TSCRIPT-141209-211
Name
hpn-201
Previous Names
  • hpn-001
  • ch73-124g13.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044949|OTTDARG00000035276|ZDB-GENE-141212-373 hpn|OTTDARP00000035554 CH73-124G13.3-001 LG_ FP016247.6 Danio rerio protein_coding KNOWN, 5510 bp
GACAAGAGCCGGAAAACAGAAGCTTCATTTAACACCAAAT
AAAAGAGCCTTAGACTCCGGGGAAACGGAAATGTCAGCGC
GAATATCTGAAGAAAACAACTGATTAACGTTTTTTTCAGC
TCTTTGTTACTTATTCACGAGTTTATTCAAGAAGCTGAAG
TGAAGAGGTGGAGGTCTGAAAGAACATCAAGTCGGATTTT
TTGAGGAGGAATCATCTATTGGAAGCTTATATTTCAGCTT
TCTTATTTGGATGAACATGTCAGAGAAGAAGGTCGGACGT
CCAGGCATGAGCATCTTCAGTCCATGCCGGGTGGTCGCTG
CAGTTTCTCTGATCTTGATTATTCTGGGAGGGCTGGGAGC
CGCCATCTGGGCCCTCGTCACGTACCTTAGAACAACAGAG
GATACAGGATTATTTGATGTGCAGGTGAGTGCAGCAGACC
AGAGGCTGAGAGTGTTTGACTCCACACAGTGGAGGTGGAA
ATATGTTTGCTCATCCAGTGTCAACCAGCTCATCGCCAAC
ATCACCTGCGAGGAGATGGGCTTCGTTAGAGCAGTAAATT
TCTCAGTGACGTGTGCTCCTGAGAGTGGCGGGGACCGAGA
TTTTTTCTGTGTAAAAGAGAGCGAGTTAACATATGGGAAG
AAGATAAAAACAGCCCTCTATCCTTGTAAATGTGACAAAG
GGCAGATTCTTGAGGTGATCTGTCAGGACTGTGGTCGTCG
AATGCTGCCTGAGGAGCGGATAGTGGGGGGAGTGGATGCT
CGACAGGGCTCGTGGCCATGGCAGGTCAGCTTACAGTATG
ATGGAGTTCATCAGTGTGGTGGATCCATCATTTCAGACCG
CTGGATCATCAGTGCTGCACACTGCTTTCCTGAGAGGTAT
CGTCACGCATCCCGCTGGCGGGTTCTGATGGGCTCGATCT
ACAACACTCCCATCCGTAAGAATGTTGTGATCGCAGAGGT
GAAGACGGTCGTCTACCACAGCAGTTACCTGCCCTTCGTC
GACGCTAATATTGATGATAACAGTCGGGACATTGCAGTCA
TCTCATTGACGAAACCTCTGCAGTTCACTGATTATATCCA
GCCCGTGTGTCTTCCGACCTACGGCCAGCGTTTGGCAGAC
GGACAGATGGGTACAGTTACTGGCTGGGGTAACGTGGAGT
ATTATGGAACTCAAGCAAATGTCCTCCAGGAGGCCCACGT
GCCCATCATCAGTGATGCGGTGTGCAATGGCCCTGATTAT
TATGACAACCAGGTCACAACCACCATGTTCTGTGCTGGTT
ATGAGAAAGGAGGAACAGACTCATGCCAGGGGGACAGCGG
TGGACCTTTCGTAGCAGCAGATGTGCTCTCTAAGACCAGC
CGCTATCGTCTGCTGGGAGTTGTAAGCTGGGGCACAGGCT
GTGCTATGGCCAAGAAGCCTGGCGTTTACACACGTGTGTC
CCGCTTTCTGCCGTGGATTTCAACTGCTATGAGGATGTAT
GAGAATTCCCCAGGAGTGCACAAAATGGCACGAGCCGCCA
CACCATAGTAATTCACAACGGAACATGTTGTATTTGAGAC
TGAAGTATTGATGTGTTGCTGGGATCGGTCTGAGATCAGA
CGTCTGCTGTGGATCAGATGTTTTGAGATGATCAAACTGG
CTCAAGGACATTTGGCTAATAACTTTCGCTTGGTCTGACC
CAAGGAGGGCCTTGATGATGATGAAGATGCTGTACTTTGG
GTTTAATATGTTTATGAACACCTCATTTGTACAAAACCTA
AAACCTTTTCCTGACATCAAAATGTGGCAGATACAGTATG
GAAATTACTCACTGAAACTTAAAAAAAAAAAACTTGCTTT
ATATAGAGATGGTACTGTTTAAAGGTTTAGTATTGGTTTG
TTTTTGATAGAAGTCTCTCTCGCTCGCCAAAGCTGCATTT
ATTTGCTCAGAGTACAAAAACACAGTAATATAGAAAAATT
TGTAAAAGATGTTAATATGTTGAAAACGTTAAAATGATCG
TCCAGTTTGATACTTGTTTCAGCTTCAAATTGTTGTGGAA
ACTTTATTACTTTTTAGGATTCGTTGATGAATCCAAAGTT
CAAAATAATAGCACTTATTTGAAATGTATTTTCAACATGA
AACTTTTTTACTGTAACTTTTGATTGATTCATTGTGTTCT
TGATGAAAAAAATAACATTTTAAAAATCCTTTATAATATT
TCAGTAATTAATTTTAAATAAAAATGTAATTTTCACTAAA
GAAAGTTTTGAATATTGATAATAAGCAAAAAAAATCTTAA
TAATCAATAAACCAGCAAGAAACAAGAAAACAAAATCTTT
AAAATAAATAAATCGGCATATTATAACTTCTGAAAGATCC
TGTGATACTGAAGACTACAATAATGATGCACTAAATTCAA
CTTTCCATCACAAGAATTTAAAGTTTAAAATGTTCACATG
GAAAATAGCTACGATAGGATTTATACATATATAATAATAT
TCTGTTTTATTACATTTTTTTATTAAATATATTAATTCTT
GCTGAGCAGAGGACTCTTTTTTTTAACTCAAACATTCAAA
AATAACCAATATCAAACTGTTTGAATGGTAGTTTATATGA
AAAAACATTCAAGGATATTTTTATCCTATTTGTCCTGTAG
GTTTGTACAGACTGTAAGGTAGCAAGACGGATTAAATCTG
TGATCAGTTTCAGCTCTAGTTAGATTGAAATTTCTGTTTT
TCGTTCATGCATCTGAAAAAATACAATTAATATTTAAGAA
ATAGAATGCTCCAGAAATTAAAAAAAGTACAATGTGTTTT
AGCACATTCTGAGATCTAAGAAGTAGGGGTGTGCGATATT
GCCAAAATCTAAGTATATCTAAAAAAAAATTTTGTAATGA
TTAAATTATATTTTGTTGAATATGTGTGTTGCACTACAAC
CTTTTAGGCCTCTCATTGAGAAACACATATGACACTAAAA
CCATCAATAGGTGATTGCAACTCCAATGCTGAGCCCAAAT
TCACTTACTTAAACTTAGTCTTAAAACCATCAACCTTATT
TGTAAAGAAAAACATACTTTGAGTGGGTAACAAAAGAGTA
TGCAAGCATTGAGACATACTACCTGCTCATTCTTAGATCA
TTTTTTTGCTTAGTAACATGCACTGTCAATCATAATGAAA
CATCATCCACATTCTTTCATATAAAATGTCCTAGCATATA
CTAAAGCAGCAGCAGCAGCAGCAGATGGATCTGCCATTCA
TGAGTCTTTCATGTAGAGAAATCTCCTCAGGTGTTTGCTT
ATTTGCGCATTTAGAAGTTAATGGCCAAACACGCCTGAAC
AAAGTTCACATTGTTGCAGATGAAATATGAAGAATACGAA
GAGCGATTTAAATATTTTCCAGCTTAGATATTAATTAGCA
TGTAGTCCTTCAAGCAGCTTTACCAAAGCCTCTCCACTTA
ACAGTCAGTCTCATGCATCCACCATGTTTGTAGTTCAACA
CTTTTTACCCACATTTGTAGTTCTAATTGAATTCATGTCT
GATGCGCAATGTATTGTCGGCAATATTAGCTATAAGAGTA
AGCACAGATCTACATTTCCAATTTCTACCAGAAATAGTAG
ACCATCCAAGTAACTTTGAAATACTCAAAACATCATACTA
CGAATTGGGACATACCAATTCTATTTTCGAATACTATTTA
GGAAATAGTATGTGAATTTGGATGCAGCACTTGTCATAAT
GAGTGATTTAATTGATGACTCTTTTTACGAGCTCAATTAA
TTAAAAAGCAGAATCATTCAGCAGCGAAACACTACAGTGT
TCTTCTGAGACGCACAAATGTTCTGCACCACCTTTAAAGG
ACAGTTTTCTTGTGCAAAACAGAAAAAAAGAAGAAAATAA
GTATCACATTTGTGATCACACATGCTATGACAACGTTAGT
GTGATATTATTATGATATATTGTAAATATATATTACAATA
AACAACATCGAAGAATATTTTTGGTTCTCGTAACTTTAAA
TATAGTCATTCTAACAGGCTTCATGTTGCAGTGAATGCTT
TTGATCTTCGTTTATTTGTTTGCTAGTTTTTTTTGCAAAG
TAAGTGACATATTCAATAATGTCTTACACTGTTAAGAAGT
ACAATTTTAATATCATAAACCAGTGGTTCTTAAACTTTTT
TCACCAAGTACCACCTCAGAAAAAAAAATTGTCTCTCCAA
GAACCACCATAATCAGGGGTATTGAAATAAAGTAGCGTAG
TTGGCCGAATTAAGCAGCTACAGCACTGCACAGTTCGAAA
ACGAGGCAGAGTCATATTCATTCAACGACATTATATTCCA
TACAAAATAGAAAGCTGATCAGTCAGTTCTTGTCACGTGA
CTCGCGGTGCAGCATTCTGAAAAGGTAGGATGTTTTCAAC
TGTGCACGCCTGGAATACACAAATGCGTCATGCTGCAGTA
CTCATTTTGCTAGCCTGTGGGTTGAATTGTGGCACTCAAG
TGACCGAGATGTAACGAGAGAATACGGTCATTTTTGAAAA
TAAAAGATTTTTTTTTTTAAATGAACGATCGTTCAGACTT
AGATTATAAATAAAACGGAAATAATTAATGATTTTTTGTG
CGACCCGGTACCAATTGAACTATAGACCATTGCTTGTTTG
TGGCCCGAGGGTTTGAGACCACTGCTCTATCAAGTATCTG
CTCTGCAAGCACCACGCACCTCTTTCTCTAGTTCTGCACC
AATTAAATAGATTTATAGCAGCTGATGATGCGATGCACTA
AAGTAAACATTTTACGCACATCGCTTTGATTGTAGGCTTT
AGAGAACAGCTAATGCTGATCACATTGGTGTTATTGTACG
AATCAAATTCATTGCTCAGTGATTCCTCCGCTCACCACTA
GAAGTAAGCTTTGAGAACCTCAGTCATAGACAATAAATAT
CACACACCCCTACTGACAATAACTCTCGCCTTTATCTCAC
TCTTCAGTATTTATCTCAATTTTGTTTACTAGCGGTACAC
CTACAGTATAATAATATTATTAATAATATTAATAATAATA
ATGAAGCATATAAATCAAATCTTTATGACAAACAGAAGTT
TACTGAATAATACAGGCCTTTGTCAAATGTGCCATGATGT
ACTTCAATAGGTTTTATAAAAGTAAAATGGCCAGAACGCT
GACATTTATAAATGTTCGTTGAAAACTACATACCTTTGTG
TATTTAGCTTTTTTTTTTTTTCTTAAAAGGAATAAAAAGC
AATAAAAACCAAAGACTGGTTCAGAGAGCAGTATGCATAA
ACTCTTTGCTGTGGCAGTCAGTATTGTTGCGTATATTGTT
GTCACTGTTGTACATATAATGGCTTCTTTGCTATGCAATG
CACTGTTTAATTCAATTGTATGTCTAATTTTATGTTCAGC
TGCTACAGTGTGTGTTTATCCAGATGTTGTATCATAACAT
TGAGAGTAACATTTGTAGTAATTTGGTAATGCTTTAGGTC
AAATATTACGACAATAAAACATACAACTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations