Transcript

atp10b-002

ID
ZDB-TSCRIPT-141209-2103
Name
atp10b-002
Previous Names
  • ch211-215g18.2-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061162 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061162|OTTDARG00000042375|ZDB-GENE-130530-796 atp10b|no_translation CH211-215G18.2-002 LG_ BX120008.9 Danio rerio protein_coding NOVEL, 303 bp
GCTCCTGCACACGTCCGACCCCAATGGAGTGTGTCATATG
GAGACTGCAAATCTGGATGGAGAAACCAACCTCAAGCAGA
GAAAGGTGGTGCCAGGCTTCTCTACTCTGGGTGAACCCTT
TCAACCTCAGACATTTGACAGCACAGTTGTGTGTGAAAAC
CCCAACAACAACCTCAACCTGTTCAAAGGTTTCATATCCA
CACCAATGAACAGCGTTTGTTTGGCCTTCACATGTCATTC
TCCAATCAGGGAAATTGCATCAACCCTCTGATGCGTCACA
ATGAAAAACATGACATTTTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations