Transcript

si:dkey-23f9.8-201

ID
ZDB-TSCRIPT-141209-1991
Name
si:dkey-23f9.8-201
Previous Names
  • dkey-23f9.8-001
  • si:dkey-23f9.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060789 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060789|OTTDARG00000042138|ZDB-GENE-141216-39 si:dkey-23f9.8|OTTDARP00000046976 DKEY-23F9.8-001 LG_ BX324177.48 Danio rerio protein_coding PUTATIVE, 1011 bp
TTATTGTGTTGTTTTGAACTTCGCTCTGTCATTGGCATCT
GATCTCGGCGTTCTTCGTGGCAACTTATTCGCAGACTATT
GATATTATTGATCGTTGGATACATCGATTGATCGCCTGCT
GCTCCCTTCATTCAGGTTTGACCCTTGCTATCACACTGTG
TTTTGTGTTCAGTATGTCTTGTGTTCATTACAGGTTTCAG
AGTCGACTCACCTACGACTCGCTCCAGTTTGAGGGCCTCA
ACATCACTGTGGGAGAGCTGAAGCGGCAGATCATGAGGCG
CGAGAGGCTGAAGTTCTGCCAGCTGAAGATCAGCAAAGCC
CAAACTGATGAAGAATACACAGATGATGATGCTCTCATCC
CCAAAAACACGTCGGTCATCATCAGACGGGTCCCTGCTGC
TGGACTGAAGTCCTCCAACAGAAGATTTGTTGGACATCAA
GCTGGACCATCAGCCAAATCCTCTCAAACAGGTGATTCTT
CACTCCTCTCACTGGAGCAGCTGTTGAAGACTGAGAATCT
GGCTGAGGCAAAGGCATCAGAGGAGGACAAGCTAAAAGCG
ATGATGTACCAGTCCAGTCTGTGCTACTACTCCAGCAGGG
CAGCAGCTCTGCTTCGCACAAGCGCATCAGGAGGAGCACA
GGGATTCCCCGCAGCTTCCTGTTGGAGGTGGACGACCCAA
ACCGAAAGGGAGTCATGATGGACGGCAGCGGCAAATACGT
CATTCCCATCATAGACGCTGAGGCCTATGCTGCTGAGAAG
AAAAAGAGGCCGTCCTTCTCCTGCCAGACCAAGCCGCTGT
CCTCCTCTTCCTCAGCTGGTGCAGCATCTTCAGTCCAGGA
CGCCAGAGGGAAACGTTCCCGCTCCCCATCTTCACCAGAG
ACGCACGGCGACCAGAAGAGACCACGTCACTGAGAGACCT
TCACCCAAGATACCTGGAGCCGACGTGAGCACAGTGTATA
TATTGTACATAGTTTATGAATAAAACTGAATAAAGATTAT
AGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations