header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1984
Transcript Name: si:ch211-247n2.1-201
Previous Names: ch211-247n2.1-001, si:ch211-247n2.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060767 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060767|OTTDARG00000042126|ZDB-GENE-141216-101 si:ch211-247n2.1|OTTDARP00000046963 CH211-247N2.1-001 LG_ CR855338.5 Danio rerio protein_coding NOVEL, 1652 bp
CTCTTGTTGCAGCAGCAGTCATCTGAAACATTTTGAGCAC
ACTGGCTTACACTCAGCGTTAGCACGTCTCTCTCACTAAT
AGTGCTCTTTGCGAACAGGCTTAACCAATAGCACATCTGC
AGAAAAGTTTAAAACGCCGCTGACAAACACAATCGCCTGG
TAGGAATGGGATTATCGGCCAGGTAATCCGGTAAAAGAAC
AAAGACACCTGAAGAAACACAAGATCCTGGAGGGACTGAT
AAATGGATTTGCTGTAGTGCGGCTACAGTTTGTGTCGCAC
CACCAGCAGTGTTTTGCAAGTGCTTAAGAGAGAGACGGTC
ACTGTGGAAGAGCGGGGAGAATGTTTCTGTGGGCTGGAAG
CAAAGCAGCTCAAGGATCAGGAAGTGAGAGAAGCAGGACG
ATTTATCAGAAGATTCGAGAGTATGATATTTTGGAGAAGA
GGAGGACGGTGACCGCGCTGAAGGCTGGAGAGGACAGAGC
CATTCTCTTAGGCCTCAGCATGATCCTATGCTCCGCCATG
ATGTACTTTGTGTTGGGCATCACAATGGTGCGTTCTTACT
CAGACAGTGTTTGGACAGAGGAGTCAAACTGCACAGTGTT
GAACTCGAGTGTAGTTGCTGAGATTAACTGTAGCTACAGC
TGTGGTTCAGAGTGCCGGAAAAGCTCCAGGTATCCCTGTC
TTCAAGTGTATGTCAGTTTGGACTCTGGTAAAGTTCAGCG
GCTCTCATACAACGAGGAAGCGCATGAGGCCAATCCTGAG
TGTTTTTACATCCCAAAGTGCCGAAAGGAGCAAACACTAA
TGCACACCATAGTGATGAACATCTCGGAGCGGCTCAAGAT
GCACCAGCAGGTTCTGTGTTATTATGACCCCTCAGAGCAG
CAGGACGGCGTACTTCTGACACGTCTCTACGGCCGCGGAG
CGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGT
CGGGGGAACGCTTATCATCGCAATGGTGAAGCTCACTCAA
TACCTGTCCTTCCTGTGCGAGCAGATCAGCCGCATTAAAA
GGATGGGGCTTTACTCCTTAAGAGGAGCTTCTCATGCTCA
GGTCTGCACCCGGAAGTTTAACGGCGGCATCCAGGATGTG
GTTTGATATGCGAATTTGGACCTGTCTCCTACTCAACAAA
GTGTTTTGCCTGTTATGTTGTCTTCCTCCTGCTTTGTCCA
TCTGTCCGGGTTGTGCTGACAAGGATGGAGTATTTTTATT
TGTATTTTTTTGTGAATGAAAACTTCTTGAGGATCAATAG
AGCCCCTAGTATTTGGAACTTCATGCTACCAGACTGGGTC
AAGTCTGATTTTGAAACTCAAGGGTCAAAATCTGTGGTCA
TGTTGTGGGGTGTTGATTACACTTTTAGACCACCGGATTG
CAGAGAGTCCTTTCCAAGAAGATGCCACTGTGTAGGAATA
GGTCTCGACCAGTTGGCTTGAATGTAATCATGGAAATTAA
TAGTATGCTTTGAACACACTACTTCAAACAGAAGTGACGG
CTGTCATTCATGGCTCTTTGACAAACACTTGTGGAGTACT
TCAGAGCCAAAGTCATTTGTTGCTTGTTACAGTGTATCTT
TTAAAGGGCACCTATGGTGAAAAATCTACTTTTCAAGCTG
ATGGGACAGACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-247n2.1-201 Contained in:
OTHER si:ch211-247n2.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060767 (1)
  • Ensembl_Trans:ENSDART00000052698 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB895595 (1) 606bp
    CITATIONS (2)