Transcript

clk4a-202

ID
ZDB-TSCRIPT-141209-1903
Name
clk4a-202
Previous Names
  • clk4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060486 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060486|OTTDARG00000041964|ZDB-GENE-030131-576 clk4a|OTTDARP00000046742 clk4a-001 LG_ FP102782.3 Danio rerio protein_coding NOVEL, 1276 bp
TTGGAGCTCGCATTGCGCTGAAGATCATTAAAAATATTGA
GCGCTATCGTGATGCGGCTCTATCTGAGGTTGAGGTGCTG
GAGCAGATTAACTCGCTAGACTGTGACAGGCGATATGCTT
GTGTGCGGATGTACGACTGGTTTGATCACCACGGGCACAT
CTGCATTGCCTTTGAGCTGCTGGGCTTGAGCACGTATGAT
TTTCTGAAGGAAAATAACTTTCAGCCCTTCTATATCAACC
ACATCAGGCACATGGCCTACCAGATCATCAGAGCAGTCAG
ATTTCTTCACAAGAACAAGCTGACACACACTGACCTGAAG
CCAGAGAACATCCTCTTTGTTAATTCGGAGTATAACATTA
GGTACAACTCAAAAATGAAGAGGGATGAGAGAACTGTGAA
GAATCCTGATGTAAAAGTGGTGGATTTTGGGAATGCAACA
TACGAGCATGAGCATCATACATCCGTAGTGTCCACACGGC
ATTATAGAGCTCCAGAGGTTATTCTGGATTTGGGCTGGAG
TCATTCCTGTGACGTGTGGAGCGTGGGGTGTATTCTCATT
GAGTACTATCTAGGATCCACTCTATTTCAGACCCATGACA
GTAAAGAGCATTTGGCCATGATGGAGCGAGTGCTGGGCCC
CATACCAACACACATGTTGCAGAAAACAAGGAAGTCGAGG
TTTGTTCGCAATGATAAACTGGACTGGGACATTCACAGCT
CTTCAGGACGTTACGTCAGGAAGCAGTGCAAACCCCTTAG
ACAATACTTGGTCTCTTCTAGCTCAGACCATGAGCAGCTG
TTCGATCTAATAGAGAGGATGCTTGAGTATGACGTTACAA
AGAGGATCACCTTGGACGAAGCCATCAAACACCCATTTTT
CAACTCTATCAGGAAGAGCAAGAAATAAGTGGATTTTTCT
GGATTTTCCTCTCTGAGAGAGGCTGTTTCTCTGACTGCAT
CAGTCCCCTGTATAGATCATACAGTGCTCTAATCGCTACA
GCTGTATTTATTGTGCTTTTTTCAGTAGGAGTTAAGTGAC
CTGTTGCTCTTGAGTTTGTAATTTGTTACTTGTGTTGAAA
CAGCATCATCAGACTGATTATAAACTGTGATTATAATTAT
GAAGGGGCTGGGCTTTAGGGTGTTAGGTTTGTAAGATGCT
TTATATTTGTCATAGATTTCTTAGCATTGTTAATAAAAAT
GTAGTGGTATCTGTAAGTGTGTTTTCATTTGTCTTTCTCC
ATGATTCTTAAAAATAAAAATCCGTTTGTCATCGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations