Transcript

kdm2bb-201

ID
ZDB-TSCRIPT-141209-1894
Name
kdm2bb-201
Previous Names
  • kdm2bb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060458 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060458|OTTDARG00000041941|ZDB-GENE-080225-13 kdm2bb|OTTDARP00000046723 kdm2bb-001 LG_none 1 BX005006.10,CABZ01075929.1,FO704696.1,CU928082.10 Danio rerio protein_coding KNOWN, 4722 bp
TCACAGCGCACTACACTAAAATGGTTCCTACTTTAGTTTT
CAGCACAAGCAATCAAAGTGTGCGCAACTTCGCGCGTGAA
AAATGCCCGAAATAACGCGCTAAAGGGGGAAACAAACACG
GACAACTCGGACATGGAGGCGTGCGCAGAATCCGGACGCA
AACTGCGCTCGATCTGCCGGAGGATGTACGATGAGAATGA
GGATCTGTCAGATGTGGAGGAGATCACCAATGTCAGGGGC
TTCAGTCTGGAGGACAAACTGGACAGCGCTTCATACAACA
GCCAGCTAGTGCAGTTCATGGAGGGGAAAGATTTCACCTA
TGAATATGTTCAGAGAGAAGCGCTGCGGACCCCGCTTGTG
TTTAAAGCCAAAGATGGACTGGGAATAAGGATGCCGGATC
CAGAATTCACTGTGAGTGAAATCAAGGGTTTGGTTGGCAG
CAGACGACCGGTGGATGTGATGGACGTCAGCACACAGAAG
GGTTCAGAGATGAGTATGGCACAGTTCGTCCGCTACTACG
AGACTCCCGAAGACGAGCGCGATAAATTGTTCAACGTCAT
CAGTCTGGAGTTCAGCCACACCAAACTGGAGAACCTGATC
AAGAGACCTACAGTGGTGGATCTGGTGGATTGGGTGGACA
ACATGTGGCCGCGGCATCTTAAACAGAAACAAACGGAAGC
CACGAACGTCATGTCTGAGATGAAATATCCCAAAGTTCAG
AGATACTGTCTGATGAGTGTGAAAGGCTGCTTCACTGACT
TCCACATCGACTTTGGCGGCACATCGGTTTGGTATCATGT
CTTCAAAGGACAGAAGGTCTTCTGGCTGATTCCTCCAAAC
GCACATAACCTGTCTCTGTATGAGGACTGGGTTTTGTCAG
GCAAACAGAGCGACATCTTTCTGGGTGACCGAGCAGACGG
ATGCCAGAGAGTCGAGCTGAAGCAGGGATACACCTTCTTC
ATCCCATCAGGCTGGATTCATGCCGTCTACACTCCAGAGG
ACACCCTGGTGTTTGGCGGGAATATTCTCCACAGTTTTAA
CATTCCCATGCAGCTCACTGTCTACGAAATTGAGAACAGA
ACAAAGGTGCACTCCAAATTCCGCTACCCGTTCTTCTATG
AGATGTGCTGGTATGTGCTGGAGAGATACGTCAGCTGCTT
GACCAAACGTTCGCATCTCAGCCTCGAGTTTCGCAATCAC
ACTGCTGAACCAAAGCCAGTGACTGAGAGTCTCATGTCTG
CTACTCGGCTGGACATGGAGGAGGACTCGTGTGGGACAGA
GGGGACGATTCTGTCCTCTTTTTCCATCCCGCCCTGTCAG
ACATTTAAACCGTCGGCCAATGATTCAGAAGACAGCTCCA
AATCCCTTCCTTCAGAGTGTCCCAAAACGCCGTCCGGCTC
CCCGGGAATGGATCACTCGGGAAAATGGAGCCACCTGACA
GAGTTTGAGCTGAACGGACTCAAGGCTTTAGTGGAGAAAC
TCGAATCTCTTCCGGAAAATAAGAAATGCGTCCCTGAGGG
CATCGAGGATCCACAAGCACTGCTGGATGACGTCAAGGTT
GTCTTGAAGGAACATGCAGATGACAACCCCAAGCTGGCCA
TCAGCGGTTCCCCAATCGTTTGCTGGCCAAAGAAGACATT
CAAGCCGCGGCCGCTCAATCGTCCAAAACCCAAGATGGGC
TCGTCTCCATGCGCTGCCCCAGGCTCGACAGCAGGAGGAA
TGAAGCTCTCGTCGGGTCGTGGGTCATCGAGTGCCCGGCG
CAGACGGACACGATGCCGGAAGTGTGAGGCATGTACAAGG
AAAGAGTGTGGAGAGTGCCACTTCTGCAAGGACATGAAGA
AGTTTGGTGGACCGGGCCGCATGAAGCAGTCCTGCATCAT
GAGACAGTGCATAGCGCCTGTTTTACCTCACACTGCGGTG
TGTGTGGTGTGCGGAGAGGCTGGGAAAGAAGACACGGTAG
AGGGTGAAGATGACAAATTCAGCATGATGTTAATGGAGTG
CTCCATTTGCAGTGAAATCATCCATCCAGCATGCTTGAAG
GATAAGGATGCTGGTGGTGTTGTGAATGACGAGTTACCAA
ATTGCTGGGAGTGTCCGAAATGCAATCATGCTGGAAAGAC
AGGGAAACAAAAAAGAGGCCCAGGGTTTAAATACGCCTCC
AATCTCCCTGGATCTCTGCTCAAAGAGCAGCGAACATTGA
TAAAGGAAGAACCGGACATGTCAACCGAGACCACTGCTGT
TTCACCCATCACGAAGAGGAAGACGGAACATGAGGACAAC
CCAACCTGCAAGTCAGAAGACGCACTAAAGAAACGTTCCC
CCAAACTGGAGGACAACCCGCTTCGCAAGAAGAGAAAACT
CTTCGAAAAGGACTCAGACTCCAATTCCATCATCAGGAAA
AAGAAGAAGCGCACCAATCCTGATGATCTCTCAACCTCTT
TGATCCTGGGACACATCAAGAAGGAAAGAGAGGACGATGA
GGAGTACGAGGAGCAAAACCAACCAGAAAGAAGCTTTGTG
CCCTCAGAGGAAGAGGATGGTGATGATGAAAGAGATGAAG
AGGAAGAAGAAAAAGCGTTAAGTAGCCGAAAAGAAAATGG
GAAAGTTTCACATAAGACATTGGAAAGTGACCAATCACAA
GGCGGATTAACCCAGGCGGGTCCCTCTAGCACTGACGCAC
AGTCAAAAAGCCAGCGAAAACCCAAACGTAAACCTCGACT
GCCCAATAAAGAACTGAGTAAAGAGCTGAGCAAACAACTG
AACCAGGAGATCCAAAAGACTGAGGATCGCCTGGCACATC
AGAATGGCAGGACGGTTAAGACTGAACCCAGTAGTGACGG
AGAGGACAGAAAACCACTGAATAATGGCAGCAGTCATCTT
CGGGATTGGCTGGGGCCTAAATGGGAGCTAAACGGATCGT
TGCGAGAGCAGACACCGGTGAGTTTGATTAGGACCACCAC
GCCTGCCCCTGTCTTCCGGCCCACACCTTGTCGATCTCCG
CCCAAATGTGTCCAGATGGAGCGCCATGTTATCCGTCCAC
CTCCAATCAGCCCCCCGCCAGACCGACTACCTCTGGATGA
TGGGAAAAACCATGTCCTGCGGAGGGAGGTGTGGATGGGA
GTCTTCAGCCACCTCATCCACAAAGACCTGTGTGTCTGTA
TGAGTGTCTGCAAGACTTGGAACAGATGGTGTTGTGATAA
AAGACTGTGGACCAAGATCGATCTGAACCGGTGCAAGTCG
ATCACTCCGCTCATGCTCAGCGGGATTATCCGCAGGCAGC
CCGTCTCCCTGGACCTGAGCTGGACCAACATTTCCAAGAA
GCAGCTCAGCTGGCTGATCAACAGATTACCTGGTCTGCGG
GTTCTGCTGTTGGCGGGCTGCTCGTGGGCCGCAGTTTCTG
CTTTATGCACATCCAGTTGTCCTTTATTAAGAAATCTAGA
TGTACAGTGGGTAGAAGGACTCAAGGACAACCAGATAAGA
GATTTACTCTCTCCACCGACAGACAACAGACCAGGTCAGC
TGGATTGCAGAAGTAAGCTGAGGAATGTGGAGGATCTCTG
TCTAGCCGGTCTGGACATCACAGACACGTCGCTGAAGCTG
ATCATAAAACACATGCCTTTACTTTCCCAACTGGACCTCA
GTTACTGTAATCACATCACAGACCAGAGCGTCAACATCCT
CACGGCAGCCGGCACCACCACCAGAGACTCACTCACACAC
ATCAACCTGTCAGTGTGTAATAGAGTTACAGACCTGTCGT
TGACCTACTTCAAGCGCTGCGGAAACATCTGTCAGATCGA
CCTGCGGTACTGCAAGCAAGTCACCAAGGAGGGCTGTGAG
CAGTTCATCGCAGAGATGTCTGTCAGCGTGCAGTTCAGAC
TGATGGAAGAAAAACTACTGAGCAAACTGAGCTAGTCGAC
GACACAAATACACTGGCCAAACACTTGACTTAAACCCAGG
GAACCAACCATTTTTGTCATCCATTTTCTACACACCATTG
AAACCAGCAAAAAGAAAAATGGCAACAACACACTCCAATG
CCTGAACTCCAGCAAGGGAAGAGGTTTATTCCTCTCTGGT
GGCCAACTCTGCTTTTCACTGTTTGGTATTTTTTAAATTA
GGTTGTTGTGCTGCTAAGGCAAACGGTTATTGGTTTTTAA
GTTTACAAGGCACATCTCGCAGAGCGTGCCAATGTTAAAA
CGCTGTTGAAAGGCATGTTTACCCATTTGTTTTGGCATAG
ATGTTATAAAAAAAGGTTTATTAGTCACAATGCAGTGACC
AAACCGACTGTTACTTTCTTTCTCTGAAAAGAAAAACTCG
AGATGCATGTGCTTTTTTTTCGTTACCATGCAAACGTTAA
GCGTCATGCAGTATTAATTTTTGTATCAGAAGGGATTTCA
CACTTTATGTGCAGTATTAAATGCACTTATAAATATATAG
AGAGACTTTATTGACAGTATTCAGTCAGTACAAAGTTTAT
TTTTTTTCTACGCAGTAGGAAGCAGATTCATATCTATACT
AGCTATAGTGACCGTGCAGATGTTTTTTTTTTTGTATTGT
TAATTTAAGATGTGATGTCTTCTGATGTTATACGATTGTT
CTACTACAGGTACATTCTCTTTTCCATACGACTATACTTT
CCTTGGTTTCTTTAATATGTATATATCTGGGGGAAAACAT
ATTTGCACTGTTTCACCTGAATAAATACAGATATTTTTTT
CA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations