Transcript

hrh2b-201

ID
ZDB-TSCRIPT-141209-189
Name
hrh2b-201
Previous Names
  • hrh2b-001
  • dkey-179g5.13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043100 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043100|OTTDARG00000031000|ZDB-GENE-070928-20 hrh2b|OTTDARP00000034180 DKEY-179G5.13-001 LG_ CR774179.7 Danio rerio protein_coding KNOWN, 1679 bp
ACACAAACGCAAACAGTTTCAGTGTGGTGAACATCAGCTC
ATGCAGGAATCTGGAGTTTCTACTTCACAGCCATAATGCA
CCTGCAGAATGAATGACCCTGGGCTGATTCAGCATGAATG
TTACTATAATGCCATTTTATAGCATCCGAGAGTAAATGCG
TGAGAAAATGAGTTGACGCATGGAGTCCTAAATAAACTAG
TTTGGATATTACTGTCACGCAGTACTACAAACATTTCCAA
GCTTTCCTATTTCGAAAACTAATAACAATGACAATCAGAG
CCCTGTGCTGGGTGGTTCTGGTGGCCTTCATCGCACTGAC
CATTTGTGGAAACATACTGGTTTGTATGGCCGTGGCCACC
AGTCGCCGTCTGCACCAGCTTAGTAGCTGTTTTATACTAT
CCCTGGCCGTGACAGACCTACTTCTAGGTTTGCTAGTACT
GCCACTTTCTGCCATGCTGGAACTGCGCAATGGAAAGTGG
CCTCTTGGGGGTGTTTTCTGCAATATCTACATCTCTATGG
ATGTAATGCTGAGCAGTGCTTCGATCCTGACTCTACTGGC
CATTAGTGTTGACCGCTACCTTGCCATTTCTAACCCGCTC
TTCTATCCCAGGAGGGTCACACCTCGACGGGTGGCGATCG
CTCTGACTGCGATCTGGACGTGCTCTCTAGCGGTGTCCTT
TGTGTCTATAAACCTAGGCTGGAACTCACCGGACTTCAGA
GTGCAGAATCTGGACTGGAGCATGTGGGATGAGGGAGAGG
AAGGCAGGACCTGCCGCTACGAGTGGAATAATAATTATGT
GCTGCTGAAAGCGTTTGGAATCTTCTACCTCCCTCTGCTG
GTTATGTGTGGAATGTACCATCGCATATTCTGTGTTGCAC
GGGAACAGGTGCGGCGTATTCGGGCAGCCACTCCATCATC
TGCACAGGTTGCAAATGCAGCTGCCACTGCACGGGAACAT
AAAGCCACAGTGACCCTCGCTGCAGTGCTTGGTGCTTTCA
TCATTTGCTGGTTCCCCTATTTCACCTACTTCACATACAT
GGGAATGTGGGCGATTCACCCAAACAAACTGACCCACTCC
ATTGTTCTTTGGTTGGGATACCTCAACTCTGCACTGAATC
CCATCCTTTATCCAGCCTTAAACAGGGATTTCCGTCAGGC
ATGTGGACAGTTGCTCTGTAGATGTGGGAAAAGGGGAGAT
TTCAACACTTCCAGAAGAAAGACATTCATAGCTTTAGGTA
CCATTAAAGTCATTAAAGGCTCACTGGCCCACTAGAACTC
ATCTTACACTGCAGGGACAATGACAGCATCATCAAAACAA
CTATATGACTGATCAATGACTATTAAATATTGTCGGACTG
AACAATAGAACTTCAAAATGAAAGAGATTTTGTTCGCTCA
TACTATATTTGGTGAAAAATACACATTATTCTAATAATAT
TATTCTGCTGTGTGATAATCTTCATTCGTTTGTATTTGCT
GAATAATTTGTTGCTTTACCTTTTTTTTTTTTTTGATATG
CAAGATACATTTTGTCTGTTTAGTAAAGTGATGCTATTCT
AACAGTTTTGTTAGGTTCTCTCTCTACAGTATAGGGGTAA
TGTACATACTTTACTTTTTATAAACGTTTTCCCAAAGCAT
TCTTTGGTGCCAGAGTAAGATTAAAGAGATGACATGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations