Transcript

kctd8-202

ID
ZDB-TSCRIPT-141209-1884
Name
kctd8-202
Previous Names
  • kctd8-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060428 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060428|OTTDARG00000031597|ZDB-GENE-060117-3 kctd8|OTTDARP00000046701 kctd8-002 LG_ FP085411.11 Danio rerio protein_coding KNOWN, 9787 bp
ATGGCCATGAAGGAAACAATACTCCCTATCAGCGAGGTGT
CGAGTCCGTACCCGGAGGTTGTGGAGCTCAACGTTGGGGG
CCAGGTGTACGTCACCAAGCGCTCCACCTTGGTCAGCGTA
CCTGACACCACCCTCCACACCATGTTCACGCGGTGTACCC
CGCACGAGCTGCCACGTGACAGCCGAGGACGATTCTTCAT
CGACCGAGATGGATTCTTGTTCCGATATGTGCTGGACTTC
CTACGAGATCGCCAGCTTGTGCTGCCCGAACACTTTCCAG
AGCGGGAGCGTCTTCAGAGGGAAGCCGAGCACTTCCAGTT
GGGGGAACTGCTGAGACTTCTGGGCCCACGTGTAGCCAAG
CAAGGCTCTCTCAACGATGAAGGCTGCCAGAGTGATATTG
AGGAAAGTTCACAGAGTAGTGAGTTGGTGACTCGAACTGG
ACACCATGCCATCAATTACGCAACTACTTCTTCCACGTTG
GACAAGAGGTCAGGGTTCATTACCATTGGTTATCGGGGAT
CCTACACAATGGTGAGGGATAATCAAGCAGATGCAAAGTT
TCGGCGCGTGGCACGGATCATGGTCTGTGGGCGCATCGCC
CTGGCAAAGGAAGTGTTTGGAGACACTCTAAATGAAAGTC
GGGATCCGGATCGCCCACCAGAGAAATACACCTCCCGCTT
CTACCTGAAGTTCACCTACCTGGAGCAAGCGTTCGACAGG
TTAAGCGAGGCTGGTTTTCAGATGGTGGCCTGCAACTCTA
CTGGAACGGCTGCATTCGTCAACCAGTACAGAGATGACAA
GATCTGGAGCAGCTACACGGAGTACATCTTCTTCAGACCC
GCCTGCAAGTCAGCATCCCCAAAACTGGAGCGCAAGTCCG
AGAAACTGCTGGATAAGGCCAGCGAGAGCGGAGCCTCTTT
GAATGAGCTTTCCACATCCAGCTCCGAGACCCACTCAGAG
GCCACATCTCCCCAGGACGGAGGCCCCATCCTGGTGTCCC
GCGGTGAGGTTGTAGGAGGCTCTCTGGCTCCCTGTGGTGC
CCTGCATTCTGTATCTCGGCCTCCTAGCACTCTTACTCTG
GGACGACCACCCAAGAAAGGCTCCTCCGTGCAGTGGATGG
AGCTTCCGGATAAGAGGAGAAACAGTGAGCTGTTTCAGTC
CCTCACCAGCGGGGTTGGTCCAAGGGAATGCGGAGGAAGT
GGTCTGACCCGGAGGAAGACACTGGAGTGCAGACCCAGTG
CAGAGGAGGAAATGAAACAGTGTATCCGAGATTTCCGAAA
GATCAAGATCCCTCCAGCGTTCCCAGAACGCAAACGGCAG
TGGCAGTCCGAACTACTTCAGAAATACGGCCTATGAAGAT
AACTACAGTATCTAATCTGTTCATACAATAGGCTTACCCA
ACAAACTTCAATCCTGAAAGGCCTTGTTTTACAATGAGAA
ACCAAACAAGAGTGTATTGGAAACATAAAGAAGGAACTAG
AAAGACCAGACTTTGCTTTATTATCATTCAGTTTGATAGT
GCCATCAATATTGTTGAACTAGACCTTAAATGCCTACCAA
ACAGTGGTGGACTTGAGAAAAAGCCATTCCATCATGAGAC
ATCCAAATAAACATTACCGTCTTCAGGAAGTTCTGGAAAT
AGGGATCCTAAATAATAAAATAAATTTGTGCAGTGTCCAA
TAGAAAGAACCGTTACGGTACACTATACACATGACGCAGA
TTTGACATACTTTAAATGTGGAGGTCTACATAGGTACATT
ATTAGGGCTGCCAAACAATTTACAATTGTAATTCAAAGGA
CTATAAGCTTATTAACTGATTCATTTACAGTTGTTTGGCA
TTTCTTTAAGTCTGCGTGAAATTACAATGTTTATTTTGCT
AGCGCACCATGTTATTCTTTAGATGAGCAATTCATTTGTG
TTGTTTGTTTCAAGAGTTCACACTTAGCTGATGATTGGTT
GTAAAGCTAGTTTGGCGTGCTGTCCCGGGAGAGAGCCTTG
AGCTCATAAGATCCTCGAGCCCGGGGCTCCCTCCCGTTTG
CAAGCCGTGAGGGGGGTTTCAGCTCAGCTAGACCTCGAGA
ACAGACGGTGATTGCTCTTAAGAGATAACTACTTACCAGG
AGCATGTCTATGGTGCTGATTTGGATTAGTCAATTCACTT
AAGTTGCATGTTTTCGGCCGGTGGGAGGAAACAGGGGAAC
CCAGGGGGAACCCACATGAGCAATGGGAGAATGTGTAAAC
TCCGCACAGAAATGTTGGCTGGCTTAGGAAGGACTAGAAC
TAGTACCATTCTTGCTGTGAGGCAACAGTGCTAACCACTG
GGCCACCATGCCACCCATCTAGGAAAAAAGGAGGAGTAGG
GGTGGAAGGGGGATTCTTTAAAACGAAAATGGCTGTTATA
TGGAACTTAGGGTATTTATAATCGGTTAGGAATCATCTGA
TTGGTGAATCGGAAATTGGATAATGCTTGACTAGATGGAA
GCAATCATAAGCACGTTATCCTCTCGAAATTAGTTCATAA
ATAAACTTCACTTAAGTAATCTTCAATCAAAGTTGAACCA
TTTGCTTCCCCGTTTGCATCCCCGTTACATTAGTTTGACG
TTTTAGCCACAGTATTCCTAACCATGCCCCTCTTACCATT
CGTTTGCTTTGATCTAAGATTTTTGAAAGAACAAGATCCC
TCTGCGTTTCCAGAACACAACCGGCAGTGGCAGTCAGAAC
TACTTCAGAAATACAGCTTATAAAGATAACTTGTGTTTAA
CCATAGTATCTGGGCATACAATAGACAACCCAACAAACTT
TAATCATTGAAGGCCTTGTTTTACAGTGAGAAACCAAACA
AGAGTGTATTGAAAACATAAAGAGGGGACTAGAGCCAACT
AAACACGCTACTTTGCTTTCATTATCATTCAGTTTGACAG
TGCCATCCGTTTCGTTAAACTAGACTTTAAATGCCTACCA
AACAGTGGTGAACTTGAGGAAAAGCCATTTCATCTGGAGA
CATCCAAACATTTCCATAGGAATGTTCTGGAAATAGGGAT
CCTATATCTCTATTTAAACTCTCTTCAACTCCCAAGTTAA
GTTGTCCAATAGAAAGAGCCGCTACTGAACACTATACACA
TGATGCAGATTTGACTAACTGTAAATGCGGAGGTCTTCAT
GCGTACTTTATTAGAGCTACCAAACAATTTTCAATTGTAA
TTCAAATGACTTAAAATGCTTATTAACTGATTAATTTACA
ATTGTTTGGTATTTGTTAAAGTCAGTGGAAAATGACTTTT
TTTGTTTATTTTGCTAGCGCACATTGTTTTTCTTTAGGTA
GGCAATTAATATGTGCACCCAAAAATTTTTACTGTTTAAA
CTGACCATTTGCTTTTGTTAGGAGAGTCCGTCCGTCTTTG
TTGACATCAGTTTGATTGTTCAGCCTCAATATTCTTAGCC
ACAACTCTCCTACCATTAGTTTGCTATGAGGGAATGATGT
GCAAAATTATAGCCCCACCCCTACACAGTACAATATTCAG
TTTCAGTTAGAAGTACAGTGGGTACGGAAAGTATTCAGAC
CCTCACTGCCCAGCCAGAGCCCTGACTTGAACCTAATTGA
GCATCTCTGGAGAGAGCTCGAAAATGGCTGTCCACCAACG
TTTACCATCCAACTTGACAGAACTGGAAAGGATCTGCAGA
GAGGAATGGATATGATCCCTAAATCCAGGTCTGAAAAACT
TGTTGCATCATCTCATGTTAAATTAGATCTAAAGGGGTTT
TCTTTTTAAATAAATCTGCAAAAATGTCAACAATTACGTG
CTTTTCAGTCTATATGGCGTGCTGTGTGTACATTAATGAG
GAAAACAATGATCTTAAATAATTTTAGCAAGTGGCTGCAA
TATAACAAGTGAAAATGTTTGAGGTGGTCTGAATACTTTT
TGTACCCACTGTATCATCAGCATACTAAAATACAAATCTG
AGCAACTTTCATTTCACGCTGACTTTAGGAAATCCCTCTT
TTTGCAGTCGTATCTGCCTGTCCTATTGACGTACTAAAGG
ACAGTCGTTCACCATTTAGTTTCTTTCTGGTTTATGTATA
CCTTTTAGAGTTGCATTACATCTTTACTGTCATACACTTG
AAGTCAGAATTATTAGCCCCCCTGAATTACTAGCGCCCCT
GTTTTATTTTTTTCCCCAATTTCTGTTTAATGCAGGGCAG
ATTGTTTCAGCACATTTCTAACCATAATAGTTTTTAAAAA
CTTTTTTCTAATAACTGATTTATTTTATCTTTTCCATGAT
GACAGTAAATAATATTTGACTACATATTTTTCAAGACACT
TCTATACAGCTTAAAGGGACATTTAAAGGCTTAACTAGGT
TAATAAGTTGAACTAGGCAGGTTAGGGTTATTAGGCAAGT
TATTGTATAAACATGGTTTGTTCTGTAGATTATCAAAAAA
AAAAAACATTAGCTTAAAGGGGCTAATAATTTTGTCCTAA
AAATGTTTTTTTTTTTAATTAATAACTGCTTTTATTCTAG
CTGAAATAAAAGAAATAAGACTTTCTCCAGAAGAAAAAAA
TATTATCAGACATACTGTGAAAATTTCCCTGCTCTGTTAA
AAATCATTTGGGAAATATTTAAAAAAGAAAAAAAAATCAA
AAGGGGGCTAATAATTCTGACTTCAACTGTACTTCTTTTT
CTTTACCTTAAGACGTTCAGTCAGTTTGCTCTTGGGTAAG
TGTTGTGTGTGCAACATAAATACATTTAAATATGTAAAAT
ATTTTATTGGTATCATGATGGAAGAATTGAAAGGTAAATG
ATTCAACACCTAATCAAACGTTCAGTTCCAACACACAACA
ATTTATAACTTTTTTATTTAGTGGCTATTTCTCATAAATT
TGTATGATCTCATTCGTAATTTAGTATGATTTGTTCATCC
CCCAATGACAGTTGGGTGAAGGGGTGGGGTTGGGTTTTAC
GCCTCTTTTTAAAAATCCTACATTTTTATAAGTCTAAACT
CGAAATTACGAATTAGCCACTGAACTGACAAAACGTAAAA
TAGCTACATTTTCTCGTGAGATCAGGCTGATCTGTTCACA
CTTGCAGTTTTTTTTAATTTTATCTTCTTTTATTTATTTA
AAACCAAAAAGGAAAAGTAATGTACACTGAAAAGTGTTTT
ATGATATGTGTAATTGGTAGCAAACAATGCCATGTTCTGG
TCTAAATGCATTGTATGTACTTAGTCTCAGAAATGAAGGT
ACAAAAGCTGTCACTGAAGTGATTCCTTTTCGCCAGTGGT
TAAACGGACCACCAAACTAGTAGTTCTAATCACATTTAGG
TTTTGAGCCATGAATCGTAGACTTTTTCCAAATATACACA
CCTAAATAGTGGCTCGGCGGTTAGCACTGTCGCCTTACAG
CAAGAAGGTCGCTGGTTCGAGTCTCGGCTGAGTAAGTTGG
CATTTCTGTGTGGAGTTTGCATGTTCTCCTCGTGTTCGTG
TGGGTTTCCTCTGGGTGCTTCAGTTTCCCCTGCAGTCCAA
TGACATACAGTATCCGCTTGTTAAGTGTGACGTCACGCGA
AGCAGCTTCCGGGTCCAAACGCTCTATTTAACTGAATGGG
GAGACTCATGAAATGGTAATAATAAACGTTTACAAAGCGA
TTTAATACTTTCGAAAATCACGATCGCAATATATATGTCC
ATGCCTAATATCTAATGGCCAGAAAGTAATTCTTTTTTTA
TAAATTGTAAAAATTTTAGTATTTGTTATGCAACAAGCCC
AGAGATTGTTGTGTACACTATGACTTTATGTAAAATTAAC
TTTAATGTGTGATATGAATAAAAAGAGATCCTAAACAAAT
GATTTCTTAACTCAAATGAATTTCGGCTTGGACCCGGAAA
CAGTATTACATACATCACCACTTAACAAGCGAATAGGTGA
ACTAAATTGGCTGTAGAGTATGAATGCATTTGTGAATGTA
AGACTGTATGGGTGTTTCCCAGTACTGACATATGTCGGAA
TTGTTGCTGGTTCATTCCACTGTGGCGACCTTTGATAAAT
CAGAGACTAAGCCGAAGTAAAATTAATGAATGACTAACCT
CAATACACTTAGACAAATATAGATTGCTTTCCAATTTATT
ACAAAAACATTAGTGTTTAACCAAATAATGTATGATCAAC
TTTTTGTACCTGATAGTACTTTTGGCAAGTAGATGTGTAA
TTGAGATAATATACAGTTAAAGTCTGAATTATTAGCCCCC
CTGCATATACATATATTTTTTCAAAACATTTCTAAACATA
ATATTTTGAATAACTCTTGTCTAATAACTGATTTCTTAAA
TCGTTGTCATGATGACAGTACACTGAAAAAAGTGTTGCAT
GCAGAACTGTTGCAAACTATTTATTTGTGTTGAATTTAAA
CAAACAAATTAAGTTTAATAATGTTTAACTTAATTTGTTT
ATTTAAATTCAACACAAATAAATTGCTTACAACTACTTAA
CGTAAAAAAAAAAGTCCAAGAAATCTCTGAATAATTTTTT
TCAGTGTACATACTATTTTACTAGATATATTTTAATATAC
TAGTATTCAGCAGTGACATGGAAAGTCTTAACTAGGTTAA
TTAGGCAAGTTAGGTTAATTAGGCAAGTCATCTTACAACA
AGGCTAAGAATATTGACCCTTAAAATCATCTTGTTTTTTT
ATTATTAATTAGCTTTTATTTTGGCCGAAATAAACCAATA
ATACTTTCTTGCTCAGGTAAACATAATTTGGCAAATATTT
GAAAAAGTTGACAAATTTTAGTTTTTACTTGGATACCACA
CTCTTGACAGCTTTTGCATCTTTATAACTGAGAGCATAAA
TATGATGTTTAATTTTTTTAATCAGATGAAAAACATTAAG
AACCATTATGTGAATATGAATGTGTGAAGGAGTAGAAACA
GCACATGGAATCCCTCTCTTTTGCACATGAAACAAAAGAG
CAAGTGATAGCCATAATTCAGATGACAACAGTCTTTTTCA
AACAAACTACACTACTAGAGTTGGTTTTAATTGAACCGTG
AACATAGCCAAAATCCTAAATGGACTCTGATTGTTGTTTT
TCTTTTTCTGATTTTAAAATAAGCACAAAATTTACTATAA
TGCTGTGTTTCTCAACCACGTTACTGGAGGACTACCAACA
ATGCGGCTGCATCCGAAATCGTATACTTCCATACAATATA
CTACGCTAAAAACAGTATGTGAGCCAAGTAGTATATCACT
ACTCTATCCCATACTGTAAAAGTCAGGAGTCAACTTTACC
AAATGAAGTGAGTTTAGTTAACTTAAAATTTAATCAAAGT
TAATTCTACTCATTTCAGAAGAGTTTTGAACTCAGTGTTA
AAGGTAATGAGATAATTAAATACCTCAGTACTTCAACTTA
AATCGAGGTAATTTACAGTACTCATATAGATTAGTTTTTA
ACTTAAATGGTTTGTTGCAATCGGTTTCGAGTTGCCTCAA
CTTATTGGGTTTTACAGTACTCAGTTGGTTTGAGTTCTCT
TAATTTATTGGGTTTTAGTGTACTCAAATTGCTTTGTTTA
CTCAAATTGATTAAGTTCATAGCACTCAGAATTAGTTTTT
AACTTAAATGGTTTGTTGCAATCGGCTTCCTCAAATGGTT
TGAGTTACCTTGACTTTCTGAGTTTTACAGTGCACAGCGA
GAGAATTCATAAATGGGAGTGAAGCGACACAACTATTGCG
GGTAGGTCATGTGATCATAGCAAAATGAAATTGTAGTACA
TCTGAGTTCCTTTCATTCTACTCGCATTCATACTGTACAG
ATAGTATTTTTCTAATGGCCGAGTAGTGTGTTTAAATTCA
AATGCAGCAGCCTGCATGTTTTGGATGCCTGCTTTGTCTG
TCACACCTATTACAGGTATTTCAGTCTCTGCTAAATGAGC
TGATGATCCAACCCAGGCTCATTCTGAAAACGTAGTCCAG
CGGACGTTTCTGGAGACCGCGAAATACGTCCTGGGAGGTA
CGTATGGCTGCATTTAATTTTTTTAAGCGAACGCTACGGG
GCGGTGTGACGCCGTTCCCTTTCGCGCTTGCCGGCTGACC
GCTTACCTCCGTGTGGAGGGCTTTCCCGCTGCAGTCAGTT
TTTCCGGTCAGCTCATCGTGTGCGTCGGCGGACTTCAGAT
GCAGAGAGGAGGAGTTGACAAAAGTGTCCAGGTTCGAATC
CGGGGAAGAGCGGTTCCAGAAACCAGGTAAGACAAAAACA
GAATCCAAAAAATAAATCGAACGAGTTCATAACAGGGTGA
GAGCGTGGTGAAATCCGAAAATGCAGTAAAGTAATCAAAG
CAGGGGCTTTTCTCTTTCTAGACGGCTTTTCTAAATTGTT
GCTCGGGTTTAGGGAAGTGAGCAGGCGGGCAGGTCAACCG
GTAAAACTGGTTGGGTTCAGGGAAGAAGGAGGGTGGGTCA
GCCGATTGGCCGGTCGCGCAGTCAATCATTCGGTCGGTCA
GACAGCGGCCTCTGGTGGGTTGATGCGAGAACAGCGCGGG
CGCGAACGGCACTTGCGAGAGACGTTCGAGATACGAAAAA
GCACACACAGCGGCCTCTCGCGGATTCGCTAAAACAAAAA
CTGCACAAATACGTACCTCCCGGGACGTATTTCACGGTCT
CCAGAAACGTCCGCTGGACTACGTTTTCAGAATGAGCCTG
GGTTGTGATGATCTGAATCAGGTGTGTTTGGTTAAAAAGA
CCAGGAAAATGTGCAGAGCTGGTGATCCTCCAGGAACGTG
GTTGAGAAACACTGCTATAATGGGTGCGTTTTCCACTCAT
TCCACCCCTTTAAATGATCTAATTGTTGCTTTTATATGAC
GAGCCTCTATAAAAATGATCTCCACACTGGTTCTTCTGTA
AGTGAATGATATATTGAAATCATCTGTTGTCTGGGCTGCT
TTTGCTATGAGATTTTGTTGTGCGCTGTTCACTTTCTAAA
GTGTTTATATGTGTGGTGGGTGAATCGCTCCAAATGTGTG
CGCACTCATTTCTTATTTGTAAATTTCTATAAACCGAAAG
GAAGGAATGAAGGATGTTTTGATTTTGGCATTACACTAAA
GATGGAAAGACAAGAAAGTGTGTTGCTACAAATTATTCAT
AAAGACCTCATTGTTGCCGGCATTATGGAGTGGGGTCTTC
TAAAGCCTCAGGCATGGAGATGAAAAAAATTGAACAGCAC
AAGTTGACCTCCATCATCCGGTTCTTTCACAGTTCAAAAA
TATCCATGCGAACAATTGCATCCTCTTGACACACTCTGCT
CCTAGTCTACGTTTGAGATTTATTTTGAAATGGAAATAGC
CATGGCGTCGAGCCAGTAGCGTAATCCACGTGCTGAAACC
GGTTCCAAGATATTGTTTATGGCAGAGCGTCATCCCAGAC
TCGGAATGATCTTTCCATCTGCCGTAGGCTGCGCATCAAA
TGTCAGTGAGCAAATTTTGCAGTGAAACTCCATCTCCATG
AAGACTTGTATTTGAGATGGGTTTGATGATCGCCCCTCCA
ATTGATGTGTATGGTGTTCTACGCACGTTTAAAGCACAAC
ATTCTGTAAATGCCGGTTTGAGACATGACAAGGTCTCAAT
CCAGGACACAGGTTTGAAAAGCACAAGGCAAAATATGATG
TTAAATGGGTTTAAATCAGGACTTAATGTGTTAGTCTACT
GTGAAAACAAGCTGAAATGCTCCAAAATTTGTAAAATTAT
TAGTTGTGTTATTTGTTGATTTGCCTCAGTGTCATGTAAT
AAAGGTGTCACATTATGATGGGTAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations