ZFIN ID: ZDB-TSCRIPT-141209-1835
Transcript Name: abhd8b-201
Previous Names: abhd8b-001, dkey-67m7.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060225 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060225|OTTDARG00000041789|ZDB-GENE-130530-805 abhd8b|OTTDARP00000046539 DKEY-67M7.5-001 LG_ BX255969.8 Danio rerio protein_coding NOVEL, 2403 bp
TCTACGCTGATCATTTAGAAACCAAGGAACCCAAATGGAA
GAGAAATAATCGCTTTAATGATCATAGGAAGGTTTTTTTT
TGGCTTAAACAAACATGGTGTGGTATAAAGATGTGTATAA
AGGAAGACTTGCAGTCTGTTAAACAGTTGAAATGTGAAGA
TATCCAAAATCCAACGTCCAGCATCAAGGGAAGGCAGCAT
TGCTGAACACTCTGAGGTACATTTTTGGCAGGAGGAACTG
AGTAACCCAGCACATGGTAAATTAAATTAATGGATTAATT
TCAATGTGTTTACAGATCCTGGATCAGCCAAACTATGGTG
TGCCAGTCCAAATAAGCAGAAAAGCAAGTACTAAACTGTT
TTAAGAACCAGCAATGTTTCTTGTTTCCCCAGGTGTTCAC
CATGCTCACCAGCTTTGTGGACGGAATATTCTGCTGCTTT
ACAGGGAAGTCTACCAACGTGGTTGTCCCTGTCGAGTCCT
CTGAGCCCACAGATGGTTTTGAATTTGTTGAAGTAAAGCC
AGGACGAGTTTTGAGAGTTCGACACATCATCCCAGACCGA
CCTGTGGTTGAGGAGCCAGGGACTGGGGAAGGCGGTACAG
TGAGCTGCAAGCGTAAAATCTCAGTGTACAGAAACGGACA
GCTTCTTATTGAGAATGTCAACGAAGCCACGCACCCAGAG
CTGGTGCGCTATCAGAATGGAGACAGCACTGTGGATATGG
AGGTCTCCAACTGTGAGTCTCCTGTGGTAGGCCAGGCTAC
TGAGACCCCAGCAGGAGGACAGGCTGCAGAAACCAAACCT
GCCCCACAGGAACAGCAGCAGGTGCACCGTAGGCGCCGAA
AACCCAAACGCTCAATCGTGATCGACTGTGAGCGGAAGAT
TACTTGCTGCAAAGGTACTCATCCCGACGTGGCTTTGTTT
TTCATACACGGCGTTGGGGGATCACTGGATATCTGGAGAA
GCCAGCTGGACTTTTTCTCCCAACTTGGATATGAAGTCAT
CGCCATGGACCTGGCCGGCCACGGTGCAAGCTCAGCCCCT
CGCATTCCTGCTGCCTATACCTTTTATGCTCTGGCTGAGG
ACGTCAGAATCATATTCAAGCGATATGCGAAGCGGAGGAA
TATTTTAGTTGGACACTCATATGGAGTCTCATTTTGCACC
TTCCTGGCTCATGAATATCCAGAACAGGTTCATAAACTTG
TGATGATAAATGGCGGCGGGCCCACAGCACTCGAGCCCAG
TCTCTGCTCTGTCTTCAACTTGCCCACATGTGTCCTTAAT
TTTCTGTCCCCGTGCCTCACCTGGAGCTTCCTCATGGCTG
GGTTTGCCCATCAGGGAACAAGGGAAAAGAAATTACTGAA
AGAGAACAATGCCTTCAACGTGTCTTCCTTCGTTCTGAGG
TCCATGATGAGTGGACAGTACTGGCCGGAGGGTGACGAGG
TTTACCATGCTGAAATCACAGTGCCTGTTCTGCTGGTTCA
CGGCATGTATGACAAGTTTGTACCAGTTCAAGAGGACCAG
CGCATGGCAGAGATCCTCTTGCTGGGTTTCCTGAAGGTTC
TGGATGACGGAAGCCACATGGTCATGATGGAGTGTCCTGA
TGTAGTCAACACTCTGTTACACGAGTTCTTCTTGTGGCAG
CCAGCAACCGCCTCAAAGCCCAAACAGGAAGCAGCGCCGA
CAAAGACCAACACCAAATCTCCAGAAGACACATCCAGACC
TAAAACTGCCCCGAAATCACCCTCCAAATCTCAACCTGAT
TTGCTAAGACCGACAACTGCACCTAAAACAACCAACATCG
CCACAGAAGCCCCGGCAGTAGCGGACATCAAATCTAAGGG
CAAGAAATAACTGCTTTTCCCAATATACATGTGCTGGGGT
AAAGCATTGGGCTCGTGTGATAGAACAAGTTTAATGGAGC
TTTCTGAACATTGGATATCACTGGATATTCACCAGCTGGT
TTAAAACAGTTGGTCTAAAAGCACGAGGGTCTACTTTAAT
AATTCCAGTTTTGGAGCAGGATGATTCCTAGAGGTTGTCT
TCTTTTCTGTGACACAGTCCTTTCCAAGTGATTTTTATTT
CTACCATGGGATATTATATATACTTGTATGCCATATGATG
TCAATTTTAAGGCTGAAAATGTCACATTACATAAGGGATG
AATATAAGCACTGCTGCCGCTGTTGAATCTAATAGACTAA
TATTTTGTATTTATTTATGCCAGTTTTTTTTTTTATTTGA
CTACATCAGCTGATGTCCATCAGTTCATACATGGGTCTTC
CTCTCTGTTAAAGTTTTATTTGAAACGTTCATTAGTGAAG
TGTTTTTACGTTCAGATGACTCCAGCACTGTTGCTGAAAT
ACTGTCAGATACGGTGACTTTACAATAAAAGCCATCAACT
TGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd8b-201 Contained in:
[BAC] DKEY-67M7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060225 (1),  Ensembl_Trans:ENSDART00000110033 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)