ZFIN ID: ZDB-TSCRIPT-141209-1743
Transcript Name: fam198b-201
Previous Name: fam198b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059300 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059300|OTTDARG00000041119|ZDB-GENE-100105-1 fam198b|OTTDARP00000046272 fam198b-001 LG_ CT009687.10 Danio rerio protein_coding KNOWN, 1988 bp
ATTCATACTGGAGCTCCTGCGCTGAGCGGATCATCTTGGA
GCTCCTGAGCACCATCAATATGTACCCAAAGCCAACGCTA
TTATTCAAACTTGGATAAAAAAACGACTTAACCATGCGCA
CACACTCGTACCAATGGATACGCGTTCGACTCGCGCTGGA
GATGTCGGGGACACTTTGATTTACTTGTCCTCATCGTTCC
TGAAAGTCTGCAACTGTTGTAGGAGTTATTCCGCAGTAAG
GAAGTACTTGATTGTAGCCGTGGTGTGCTTTGGTTATCTG
TTTTTCACAGTTCATGTTAGTCACACGTCCACTCGACAAG
ATAAACGCCCGGAACTGTGGACTGGAAATGGCGTTTATTC
TCAGAGTAAAACTGACCAGGGCCTCACCGATGGGGAGGTG
AATGAATCCGTGAGTCCGACCAGAGTAAATGTGGTGTATA
TAACGCTCAAATCCAAGCGGCACAAACCAGCCATCATCAG
GGGCACGGTGCGACCCAAACTCCGGAGAAAGAAAGTTAAA
GTGAAACAGCAGGATGGCATACCGGACAGAGAGAAGAGCG
AGAGGCAAAGCACAAATACTTCTGGCGGGCGACTGCCATA
TTCTGAGTTTGATGGCAGGAACGGTGATTATTCATCCATC
AGGATTTACAGTACAAGAGCTCCTCCGTGGTTCAGCAATG
AGGACATCACCGCCATGCGCTTTCTAGCGGATAGCAAAAT
TACGCAAATTGATGAAGTTGCACACCGCGATTTTTCTTCT
TTGATTTTGTTCAAAAGTGCGACGAATCGTAGCGACAATG
CCACAAAGTGTTGCGGTGTTGTCAAGCGGCCCGTGGACAT
GAGTGAAGTGTTCGCCTTTCATCTGGACAGGATCCTGGGA
CTGAACAGAACCTTGCCAGCTGTCAGCAGGAGATTCCACT
CTCTTGGAGAAGGACAGCCTTGTCCGGTGGTTTTGTGGGA
TCCTTCTCTAGGCCCCGTAGCAGATCAACCCTCTGAGAAA
CTGAACTGGGGCTCATATCAAACCTCTCTCAAACACAAGT
GCTGGCATCGTGGCGTCACACCCAAACCAGAGTGGGGCTG
TAGCAGCATACACCACCACGAATGGAGCAAACTGGTAGTC
TTTGATTTCCTTCTGCAGATTTATGAACGGCTTGATAAAA
ACTGTTGTGGATTCAAGCCCCGTCCAGAAGACACCTGTGT
TGAGCTTGGTTACCATGAGGAATGTAGAGACAAGGACAGT
ATAGAGCTAACACACATAATCCACCGCAGACATGACCCAC
ACCACCTGGTCTTCTTCAACAACAAGGGCTACTTTGACCG
AGATGAGGACAATCTGGACTTCAGGCTACTTGAGGGCATC
AAAGAGCTACCAGATCAGTGTGTGTCCGTGTTGATGTCTC
AGCGTCTCAGAGAAAAGCTCCTGCAATCGCTGTTTCTGGA
CCAGGAGTACTGGGACAGTCAGGGCGGTCGGCAAGGCATT
GAAAAACTCATTGACGTAATTGAGAGAAGAGCCAAAGTCT
TGCTCACGTACATCAATGCCCATGGGATTAAAGTAGTACC
TATGAACTCTTGACAGACGAGGCTTCAGTTTTCAATGTGT
AAGACGAAGCACCAACCTTTCGATTTCCAGTAAATGATGT
TTTTGAACCATTATGGCAGTGAAGACATAAAAAAAGTAAA
ACTCTTCCGGTCGCAATTCTCTGCACTACAGAAATGTGTG
TGTTGTAAGTGGTCTCCAGTTTAAGATGGAGTCAAGGGGT
CATTTTTGTTATTGACATTCCTCAGGTTAAAGGTGCTGTA
AGTGATAGGATCCGTTTCGTTAACTTCCACCACAATTAGC
CTCTTCATTTGACCACCTCTGCTGTCAAAAATCATGTCCA
TTAGCAAGCCTGAAGTTGAGCAACACAAATGCTGTTTTTT
TTTTTGGTTTTGTTTTTGTTTACACAACTATTATGTTCTC
AAACATACAGTACAATTCACCATTTCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam198b-201 Contained in:
[BAC] DKEY-5I20 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000059300 (1),  Ensembl_Trans:ENSDART00000112379 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN016832 (1) 950 nt
GenBank:EH434196 (1) 935 nt
GenBank:EE322957 (1) 867 nt
GenBank:EE319288 (1) 841 nt
GenBank:BI879985 (1) 711 nt
CITATIONS (2)