Transcript

slc37a1-202

ID
ZDB-TSCRIPT-141209-1695
Name
slc37a1-202
Previous Names
  • ch211-32d12.1-001
  • slc37a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054936 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054936|OTTDARG00000038343|ZDB-GENE-041114-151 slc37a1|OTTDARP00000043094 CH211-32D12.1-001 LG_ FP017279.6 Danio rerio protein_coding KNOWN, 720 bp
CTTTTGCTGAGGCTTGTGATGAAGGAGCTTCGCTATCATA
GGAACCGGCCAGGAATCGCCGTCGAGCTGAAGGAACATTA
AGCACTTTGCACTAAAAAATTCGAGAGAAACAGTGAAGGG
CATCACTGGATACAAACATTATCTGACCACTTCCTACCCT
GGACCAAATCTTGACTGAATTCTGTGCTTCGTCCTTCTCT
TTAGAGACACTTTATTCCCTTTTCAGATGAGAAATCGTCC
CTTTAGGGTGACCACAAATCAACTTTGAGGAGATTTTTTT
ACTTCCTGGACCTGAAGGGGTTTTTTTTTCCACCCAAACA
AATGAACTCGACTCAACATGCGAGATCAGGCCTAACTTTC
CCTCCAGTCCAATCATGCACAATTGCACAACCAAAAGTAG
CCTCCCTTTGCTGCTAACAAGGGGAATTCAAATGAAAATG
CAGTATAATTTTGTCTTCTAAACCCCTGGCGGGCAGACAG
AGCCTTCATTAAACACACGCAGAACAAATGTTCTTCAAAA
ATATTTTTTTTTTTTTGCCTTTTTTTTTACAGTTTAGATG
AACAACAGTTTATATAAGGACTCTTAAAGAGAGTGTTCAC
CCATAAAATCAAATCCAGTCATCATTTACTCATCCTCCAC
TTTTTTTGTTTGTTTTTTTCTGTTGAACACAAAAGAAGAT
ATTTTGAAGAATGTTGGAAACCGGTCACCATTGACTTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations