ZFIN ID: ZDB-TSCRIPT-141209-1653
Transcript Name: si:ch1073-205c8.5-201
Previous Names: ch1073-205c8.5-001, si:ch1073-205c8.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053979 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053979|OTTDARG00000037722|ZDB-GENE-141212-307 si:ch1073-205c8.5|OTTDARP00000042413 CH1073-205C8.5-001 LG_ CU929079.6 Danio rerio protein_coding PUTATIVE, 612 bp
GGTCTCCTCTGGTTATGAACAGCTCCAGCTCTCCTCCTCC
TCCGGAATCTCCGAGGAGCGCCGGATGTTGTTAGCGCGCG
GCTAATGCTAACGCTATCGCTGTTTCTCCTCAGCGACCCG
GTCGGCGGCCCCGCGGCTGTGCGAGCTCCGGTACCGGCCC
GAATCGCATGTGATGGCGTCAGCGTCCTGTCAGAGGTTGT
GGCCCGTTTCCCGCGTCTGCTGCTGAATGAACGCGGATCC
GCCATCAGACGCGCAGCAGCACAATAGCGGAGCGCGAACA
AAAGACACGTTTATCCGCCGCTGCGCTCCCGAACACCGGC
CTGCGGATCCACACGGCGGGGATTGAGCGGCTGGAGGGCT
GAGGGACCGGGATCAGCCTCTCGGTGTCGGTAACGGCTCG
GTGAGAGGGCTGAGCAGCAGAAACACGGAAGCTCATTGTG
TTCCGCCGCAGAAACAGTCCGATGCTCGGCCAGAGAGTAT
GCGCCTCCACACGAGCAGGTGAGGGCACTAGATAGGCTGC
TTCTCTAACGGCAGTCCTGTGTGCTGCTCAGCTAGTCATC
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch1073-205c8.5-201 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER si:ch1073-205c8.5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053979 (1)
  • Ensembl_Trans:ENSDART00000169429 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EL651750 (1) 678bp
    CITATIONS (2)