ZFIN ID: ZDB-TSCRIPT-141209-16
Transcript Name: b4galnt4b-201
Previous Names: b4galnt4b-001, dkey-5g18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015628 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015628|OTTDARG00000013193|ZDB-GENE-100422-5 b4galnt4b|OTTDARP00000013286 DKEY-5G18.1-001 LG_ AL928628.9 Danio rerio protein_coding NOVEL, 1158 bp
ATGAGGATGCGCTTTCCTCTGAAGAAGATCCGCAAGCAGT
TCAAACTCCTTCTGCTGCTCGTTTTACTTATGTTTGCCAT
TGGTTTCACCTATCTTCACATCAACCAAGGCAAAGCCATC
AAACTGCACTTCAACTATGGAAAAGATATGGAGAGGCAGG
CAGAAGGGATAGGGTCCAGTCCTAAAAAGCACCTCTCCTC
TTCTATCAACCCCTTTGAGCATGGGGATGCTGCTGACAGT
CAGGAAGACGGCTGGGGGTATAAAGGTCAGGCCAATCTGC
ATGTGTTTGAAGACTGGTGTGGCTCATCCGTCTCCCAGCT
CAGGAAGAATCTTCATTTCCCTCTCTACCCACATACCAGA
ACCACAGTGAAGAAAATTGCAGTGGCACCAAAGTGGAAGA
ATTATGGCCTTAGAGTATTTGGATTCATTCATCCTTACAA
AGATGGGGATTTCCAGTTCGCCATAGCGTCAGATGATAAC
TCTGAACTGTGGCTCAGCTCAGACGAGAGTCCGCTCAATG
CCCGGCTCCTGGTGTACGTGGGACAGCACGGCTCAGAGTG
GACAGCTCCAGGAGAGTTCAGCAAGTTCAGATCCCAGACC
TCCAAACCTGTGCGTCTCATGTCCTCGCGGCGATACTACT
TTGAGGTTTTGCACAAGCAAGATGACAGAGGGTCTGACCA
TGTGGAGGTTGGGTGGAGGCCTTTCCTTCCCGGACAGAAG
TTTGATGTCATTGACTCAGCTTACATCTCCTTGTACACAG
ATGAGTCCAGTCTAAAGATGAACAGCGTACATCACATCCC
ACAGACACTGGCCAGTCACTCTCTCGCTCTGCAGATCTAC
CACAGGACAGAGACACACACTGCAGACATGCTCAAACCAG
ACCCAAGAGACACCTTCTACAAGATTCCCATGATAGATCA
ATCCAGGCTGGAGAATGTTCTGCCATCTTGTGTCTACTCT
CCTACATACGTGGTAAAGGACTTTCCTATCGCACGCTATC
AAGGCCTGCAGTTTGTCTACCTTTCCTATGTGTATCCCAA
TGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAA
TGCTTCTACCGAGAGTCTCCGGTCTACTTGGAGAAATTTG
GCTTCTATAAATACATGAAGATGGATGAGGAGGAGGAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
b4galnt4b-201 Contained in:
[BAC] DKEY-5G18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000015628 (1),  Ensembl_Trans:ENSDART00000067857 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)