Transcript

b4galnt4b-201

ID
ZDB-TSCRIPT-141209-16
Name
b4galnt4b-201
Previous Names
  • b4galnt4b-001
  • dkey-5g18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015628|OTTDARG00000013193|ZDB-GENE-100422-5 b4galnt4b|OTTDARP00000013286 DKEY-5G18.1-001 LG_ AL928628.9 Danio rerio protein_coding NOVEL, 1158 bp
ATGAGGATGCGCTTTCCTCTGAAGAAGATCCGCAAGCAGT
TCAAACTCCTTCTGCTGCTCGTTTTACTTATGTTTGCCAT
TGGTTTCACCTATCTTCACATCAACCAAGGCAAAGCCATC
AAACTGCACTTCAACTATGGAAAAGATATGGAGAGGCAGG
CAGAAGGGATAGGGTCCAGTCCTAAAAAGCACCTCTCCTC
TTCTATCAACCCCTTTGAGCATGGGGATGCTGCTGACAGT
CAGGAAGACGGCTGGGGGTATAAAGGTCAGGCCAATCTGC
ATGTGTTTGAAGACTGGTGTGGCTCATCCGTCTCCCAGCT
CAGGAAGAATCTTCATTTCCCTCTCTACCCACATACCAGA
ACCACAGTGAAGAAAATTGCAGTGGCACCAAAGTGGAAGA
ATTATGGCCTTAGAGTATTTGGATTCATTCATCCTTACAA
AGATGGGGATTTCCAGTTCGCCATAGCGTCAGATGATAAC
TCTGAACTGTGGCTCAGCTCAGACGAGAGTCCGCTCAATG
CCCGGCTCCTGGTGTACGTGGGACAGCACGGCTCAGAGTG
GACAGCTCCAGGAGAGTTCAGCAAGTTCAGATCCCAGACC
TCCAAACCTGTGCGTCTCATGTCCTCGCGGCGATACTACT
TTGAGGTTTTGCACAAGCAAGATGACAGAGGGTCTGACCA
TGTGGAGGTTGGGTGGAGGCCTTTCCTTCCCGGACAGAAG
TTTGATGTCATTGACTCAGCTTACATCTCCTTGTACACAG
ATGAGTCCAGTCTAAAGATGAACAGCGTACATCACATCCC
ACAGACACTGGCCAGTCACTCTCTCGCTCTGCAGATCTAC
CACAGGACAGAGACACACACTGCAGACATGCTCAAACCAG
ACCCAAGAGACACCTTCTACAAGATTCCCATGATAGATCA
ATCCAGGCTGGAGAATGTTCTGCCATCTTGTGTCTACTCT
CCTACATACGTGGTAAAGGACTTTCCTATCGCACGCTATC
AAGGCCTGCAGTTTGTCTACCTTTCCTATGTGTATCCCAA
TGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAA
TGCTTCTACCGAGAGTCTCCGGTCTACTTGGAGAAATTTG
GCTTCTATAAATACATGAAGATGGATGAGGAGGAGGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations