Transcript

si:dkey-68o6.8-201

ID
ZDB-TSCRIPT-141209-1517
Name
si:dkey-68o6.8-201
Previous Names
  • dkey-68o6.8-001
  • si:dkey-68o6.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049912 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049912|OTTDARG00000035117|ZDB-GENE-141212-374 si:dkey-68o6.8|OTTDARP00000039168 DKEY-68O6.8-001 LG_ BX569789.4 Danio rerio protein_coding NOVEL, 869 bp
ATCTGTTTTCTTTCGCAGAACTGACAGCATTAAAGACAGC
ATTATGGACTTAGGCTTTTTCACAGACGAAAAGTTGTTTA
ATTTTTTTTTGCCAAAACAAGACAAAGATGTCTACATTAG
AGAGCCCACTAATGTTCCTCCGCACTCTTAAGGACAATGA
ACTCATTGAAGATGAACTTTATCAAAAACTGGAGGTCAGC
ACTAATGATAGTGATTTATATAATGTGTTGGAGAGTATTC
AAAAGCGTGGAATGAAGACTGTTAGAAAGTTCTGGAATTG
TGTGGACCAAGAGCATATAGTACAGCGCTACCCACAAGTC
TCTGAAATCATCTCGGAGCTGATGAAAGATCTTGAGAATC
CACTAAACCAAAAAATAAGGCCAAGATCTGTAGATAAAAG
CACGGGACAGGAAAGAGAGATTAAAAAGATAAAGATAGAG
AGCATATCTGAGAGAAATGAAGCTGGGCCATCGTCACAAA
GCACTTATTGCCAGAGGAAAATAGCTGAACATGTGGAAAG
AGGTCTGCAATGCTCTCCAGACTCCAGGACAGAAGACTCA
AGTTTTTTATTATCAACCTCTTCGGTAAAGCTCTGGGACA
TGCCTGAACACAAGAAATGGCTTCCTGTCACATGTGGAGA
AGAAGAGGCCTTACTGGATAGAGAAGCACTGTTTGACAGA
AAGAAGAATTGCATTGAACACAATGGAGAAATGATCACTC
CTTTTACATTTGAGGAAAGGGGTGGAAAAGAATCCTGTAA
GTCCTGGAAAACAAGTATATTATGCCAAGGGAAAACCGTC
AGCAGTCTCATGGAGTTGGAAATATTGAAGATGCCGAAAC
GTAAGGGAAAGTTTACCCTTCGTAATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations