Transcript

si:dkey-68o6.5-201

ID
ZDB-TSCRIPT-141209-1516
Name
si:dkey-68o6.5-201
Previous Names
  • dkey-68o6.5-001
  • si:dkey-68o6.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049909 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049909|OTTDARG00000035114|ZDB-GENE-030131-5416 si:dkey-68o6.5|OTTDARP00000039165 DKEY-68O6.5-001 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 2291 bp
GATGGTACTGTGTGAATTGTGAAACTTGAGTTCTTTAAAA
TGTGTTGGTCATTTACCTTTAGGTTATTTAGCTAAATGTA
ATAGTTTGCCTCAACATTTTTGATTGAAATTGGACATAAG
AATCAACACTAAACAATACTTTCATCAGATTCTGTGAGCT
TGACCAGAATTTATAATACGATATTAAACTATTTTGGAAA
CATGATCAGTATGGTTGCGTTTGGAATGGAAGGGTATACA
TAACCCTACACGGCATCAGACACGTATTTGTTTGGACAGA
TTTACTGAATTTCTGCTTCTCGTGTCGCCACTAAAACTTG
CTAAAACATGTAAACCTGTATTACAGAGTAACAAGAACGC
GTTAAAGGTTAAAAAAATGTTTTATGCATTTGAGTATTTG
AGGGTTACATGGAAATACCACGCGTTGGCGTCTCCCTTCC
GTCAAACACGCCCCCTCCACGTGCTCTTCCCACGTTCTAT
GCAGGGATCCATTCATTCAGTCATTGAAACCATTCCAAAC
AGGTAACAGTTTGCTGTCGGAGGAATATTCAAAATAAACG
GCAGCGTTTCTCTGGAAAGCCAGAGGTCAACAGGAGATGG
ATGGCAAATTATTCACAGATTCAGCCCTGGATGTGGCGGC
CCGCTTTACAGACTTTGACCGGCTGATGGAGATGATGGTA
AACAAGGGAAAACAAGGAGTAAAAAGAAAGATGAATCAAA
ATGACAACAAAAAGAAAAAAAACAAAAGTAAAAACTACAC
TTTTTCAGACTTGAATGGTGGATCTGGAACAAAGCAGGCT
AAAGCAAAGTGTGAGCTGAAGGAAAACTACCCACATACTG
AATTCATTGATGAGAAAAGAATAAGAAAGAAAAAAAGCTT
CAAGAAAAATTCCAATAGGATGCCAAATTCACACCAAATA
TCCAGAATTAATGAGCAGAACAATAGCAAAAATGGCATGG
GACTAGATTCAACAGATGCCTTTAAGGAGATGAGAAAAAA
GAAAGTGCTGCAGGTTTACTGTGGGAAAATGGCAGGTAGT
CTCTACAGAACGAAGTATGAAAAGGGAGAGCAGTGTATAT
TATGTAAAGGGCAGTGGTTTACACCCTGGCAGTTCGAAAA
GTTTGGAGGAAAAGCGAATAGCAAGAAGTGGAAGCGTAGC
ATTCACTGCAAGCTGTCAAACGATCCTCGGCCTGTGCAAC
TAATGAAACTCATCAAGAATGACTGTCTTTCAGAGTTTGG
ACACTTGAGGGAGTCGCCTCAACAGGGAGCGCAGACTGAG
GGAGACAGTGCAACCACGGCGCGAAATGAGACTGTGAACT
GTGGACTAATGAGCTCTTTAAAAGATATTCCACCGTCTGT
GAGAAGCATGTTTTCCAAAACTCTTGAAGTAACTGTGTGT
AGAAACAAAGAGCAAATACTGCAGAAGGAAACTATCCAGA
CAGACGATTCTTCAGATGAGTCAAAATCTGTTGCTGAAAG
AGTTAAAATGAACAGGAGAGAATCTGTGACTTCAACTGAA
GCTGCTACCAAAATGACCTCTCAACCAGTGGAATCTACTA
ACAACGATAAAGTAAACAAAGATGCACCTGCACACCCCCC
TGATGCTCCAGAGCCTGCCGTACCTTCTGTCATGGAGAAG
GCTATTCAGACCACAGAAGAAGTAACAGCTCCGCTCAGCC
TCACTTCTCCTCCTGCTGAATGGCAGAACCCAATTGAACC
AGTAGAGACTCGGGAAACAGGCCAGATGCAGTTATTTGAA
TTTCTGGCTAAACAGTTTAATACCATCAACGACACTCTAA
AATCAATTGATACGTCTTTAAAGAAGCTGGTGGAGAAGCA
GTCACATGACTCTCTGCCAGAGTCTAACAGGGGGATTCCT
GCTCTTCAAGAACACCCCCAGGTTAATTGCTTGGTCAAGC
AGGAGTAAGATACAGACGTTGTCTTGAGATGATTGGAATT
GAAATGACTGACTAAAGTTTTTAACAAAATGAAAAAGTTA
GTAGATTGATGAAATGTATATCATAGATGTTACAATATAA
AGTTATGTATCTGCATTTTATAGTCATACACGTATTATTT
TTAAAGTCAATACAGAAAGCAGTCTTTTTAACCATTTGCT
TTTTTGGTTATGCATTAAAACATGACATTCTGAAACATTT
TTATCTCACTATTTACTGTAAGGACGTTATTAATCTGTAA
TTCGACTTGTAAACCTACAGACTTGAGGCTTTTCCAAGCC
GACATTAAATTTTATCAGCCTTCCCGATTGTAAATAAACT
TAGTCCACAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations