Transcript

sp100.1-201

ID
ZDB-TSCRIPT-141209-1515
Name
sp100.1-201
Previous Names
  • dkey-68o6.2-001
  • sp100.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049906 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049906|OTTDARG00000035111|ZDB-GENE-141212-239 si:dkey-68o6.2|OTTDARP00000039162 DKEY-68O6.2-001 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 2879 bp
TTGCTTCATTCAGGCGGGAGATTTGGAAACAACAACAACT
GATTCTGCACGGCTTTTGTCAAGCCAAAAGTACACAAATC
CCCCATACAGCTCAAACTTTAACAGATCGTTGAATTCATG
GGAGTCATCGACCAAATGGAGTTGGATTTTCTAACGAATC
AACAGCTGTTGTCATTTTTCCGCCGCAAAAAGACGGAGAT
TTCGTGCATTGAGCAACCGCACATTTTCCTCACACAGCTG
AGAGACTACGACCTGTTGCCGGAGCCGCTCTTTGAGAAGG
TGAAAAAGATGCACAAACGAGATCAGAAGCAGAAAGGAGT
CTATGAGGTTCTGGACTGGCTGGAGAAAGAGAGATCTCAG
CACATGCATAGATTCTGGCGCTGTGTGTTTAAAGATCATA
TCGTGCAGAAATACCCCACTCTATGCCTGCTCAAAAACAG
CCTGCCAGATGCTGTCATTAGTTTCTCAGAAGAACCTGCA
GATGCTGAGACGCCGACAAAAGAGAGTGAAGTAACAGAGA
AGAAAGAGAAGCCGAGGAAAAACACCAGAAAGAGAATTAG
AGATGACCAAAGTAGTGAGGATAGTGGTGATCCCGGTCCG
TCTTCTGCTTCCACTCCGACTCGCAAGAAACCAGCTAAGA
AACCTTCATTCTCATCTCCTGTAAAGAAAGGAGACAATCA
GGAGATTTGGATGTTTCCTATTTATAAAACCCAGCTGCCT
GTAAAATGTGGGGATAAAGAAGGCACTCTCTATCGGGACA
AACTGCCTAAAGGAGAGAAGTGTATTTTGGCTCAGGGACG
CTGGTTTTCCCCATCTGAGTTTGAGAAGTTTGCAGGGAAG
GAGAAGACCAAAAACTGGAAAGTCAGCATCCGCTGCAGAA
ATACACCACTTAAAAAACTCATAGAGGAGAATCATCTTCA
GTGTCCTCCGATGGAGAGAAGAAAGAGGAAATGTGTCCAA
AAAAACAAGACAGAGCTGTGTTGCATCAGTTCATCGGAGA
GCTCCAGTCTAGATTCAGAAACCAGCGCCAGTTCAGAAGA
GGAAAGTGATGCTGAAGACTTCCAGGAGGAGAGCAGGAGC
TCAGGAGGAGGATCACAGTTTAGAAGTAGAGTTCATGAGG
AGGAGGAGGAGGAGGAAGATGAGATGGCAGATCTGACTGT
TTTCCAGGCTCCAACTTTACAAGTCACCTGCGTTTCACTC
ACTGGGACTCTGTACAAAGGCAGGTTTGCCACAGGGAGGC
GTGGGAAGTGTATACGGACTGAGGAACGCTGGTTCACTCC
GGAGGAATTTGTAAAGGAGGAACCAACTCTCACTGATGGA
CTCTGGAAAAGAGATATACTGTGCCATGGAAAAACTCTCA
ACTTTTTATGCAAGAAAAAGATCCTACAGATTCATTCTCT
TCTGTGTGAATGTGTGAAATGCAGCACTGATCCAGAAGAC
CTGATGGAGCAGAACAACGATGATGTGTGTTACGCATGTC
ACTGTGGGGTAGATCTGAGGTGTTGTGATGGATGTCCACG
GGCTTTTCATTCAGACTGTCACCTACCAGCTGTACCTGAA
GGCTCTGGGGAATGGATTTGCACCTTTTGCGTGTTAAAAA
CCAGTCTACAGTGGCGTGCATCCAGTAACATGACTGAACA
GGAAGCTTTTGATTCTCCAGTTTCTCAGTATATACTGCAG
TGCCACTACCTGCTGTTATGTATGTACAAGGAGGATATCC
AGAGGGTGTTTGTAGAGGATCCACGCCCAAATGTGGACAG
ATACTCTGAGTTCATTTCTCAGCCAATGTGGCTGGACAGA
ATAAAGTCAAAGTTAGAAAGTAAGAAGTATCAGAAGTTTG
GAGAGTTTGTCTCTGACTTTCGGCTCATTTTCAGCAACTG
CAAGAACTTTAATAAGGACAATGAGTTTGGTCAATTGGGT
GCCAAACTGAAGGAGATCTTTGAGGAGGAGATCCAGAAAA
TCTTCTTTATCCAATAACAGCCATCTTTTTCCAAATTTTT
CAAATAAGTGGAGCTTTAAGTAGCTTTAAATTTTTCAGTT
TATCCTAGTTTAAAGTAAGTGAGGTGTAAAGAGTACCTGA
AAATGTTACAAGTCACCAATTTGAAAACTATTTGGGTAAA
AAATCATAGTGAAACTTATATTATAAGCACCTAAAATTTT
TATTCATATACTGTAGCTCAAAATGCACTACTTTTTGGAA
CCCTGGCTCATTGGAAATACAAGCCCTCGGTTACATTTTT
GCACAACTGGGAATAAATAATTAAATATTATTTAATATTA
TGTTAATAAAATAATTGTCCAACAAATAAATATCATAAAA
ACTACTTAGATAGGTCTGTAATCGCCCGGCTATCTCCATA
TGGAAAACTTTTCTAGTCAGGTCAGTTTGCTTGGTAGCTT
GCCTTGTACATCATGCTTGGGACGTGGAGCAAACCAGGTA
TGAGTTGAGCAAACAACGGATTCAAAAAGCAGGTTAAAAC
AAAGCAATGTGCAATCTTGCTAAAAGTATGCGGCCACTAT
GTGCTTTTCTTTTTTGGTTTGCTTTTAAAAACACTTTTTA
TTTGGGTTAATAGAAGAGAGTGGATCAGTCGATTAAACGT
TAAGTCCAGTCACTTATTTATAGCACTTTATAATACAATG
CACAAAGCAGATTAAAGAAATAAAAACTAAACCATGGAGA
AACTGGAGTTTTATTATGTAATTTAAGTTAGTTTAGATCA
GTAATTGGCAGTTCTACAATAAGCAGCAATGTTGTTATTC
AGCTCATTATTCATTATTCACCTTTTAATACTTGATTCTT
AATGGATTTTTAATGTTGCAAAATTATGATGTTTTTTAAT
CATTTAGATTGTTTTATAAATAAACATTTCTTTTATGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations