Transcript

krtcap2-201

ID
ZDB-TSCRIPT-141209-1466
Name
krtcap2-201
Previous Names
  • dkey-247k7.4-001
  • krtcap2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046694 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046694|OTTDARG00000033253|ZDB-GENE-060825-91 krtcap2|OTTDARP00000036787 DKEY-247K7.4-001 LG_ CT030031.20 Danio rerio protein_coding KNOWN, 748 bp
CTGTCCGCTCTTGGCACTGCTTTTACACGTTAGCGGCGCG
TCATCTTTACTCTGCTGGCACTGGAGCTGAATAGAGTGGA
GTATAATCTCTTTCCCTCAGCTGCTTTCAAAAATGGCGGT
GAACACAAGCACGTCTCTAGTGTTGTCCAGTCTGCTGTCG
GTGCTGGTGTTTGCAGGAATGCAGATGTTCAGTCGACAGC
TGGCTTCTTCAGAGTGGCTCACCATCTTGGGCGGCTTCCT
GGGCTCCTTGTTGTTTATCTGCTCTCTTACTGCTTTCAAT
AACCTGGAGAACCTGGTCTTTGGCAAAGGCTTTCAAGCCA
AAATCTTCCCAGAGATTGTCGTGTGCATGTTCCTGGCACT
GTTTGCATCCGGTTTGGTGCATCGCGTTTGTGTGACAACA
TGCCTGATCTTCTCTGTCTTCGCACTTTACTACATCAATA
AAGTGTCAGCAGCTCTTTACCAGGCAGCACCCGCTCCAAT
TCCAGCCAAACCCACCAGCAAGGGCAAAAGGAAGAATTGA
AGCACTTTAGCCATCCCAGCACAATCACAGTCATCACAGC
ACTGTCTGCTAAAGCTACACAATCTGATGTGTTTGCCAAC
AGCACACTGTCTTTTTTTTATTCATTCCATTCAAACTTAA
AAATGTGTAACAAATTTTGTCAAACCAGTCACAGATGTTT
GGTTTTTGGTTCTGTTCGCAAAATATTTTTGTTTAAGGCG
TTTGTTATTAAAAGTTGATTGAATCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations