ZFIN ID: ZDB-TSCRIPT-141209-1442
Transcript Name: znf521-201
Previous Names: znf521-001, ch73-164o4.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044989 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044989|OTTDARG00000032250|ZDB-GENE-141210-10 znf521|OTTDARP00000035573 CH73-164O4.2-001 LG_ CU861664.8 Danio rerio protein_coding NOVEL, 2765 bp
GGGGGCGAGCCCCTTTGCCCGTCATATTAATGTGCTTTCC
CGCTATTCCAGTTCATGAAATAACACTCAAGTGTTTGCTC
TTGTTCGCCGCCTGCGCTTTCAAACAGTGGACAGCAACTC
AACCCGTTTACTGGCAGCTGCTGAAGCCCTCTATAATGTC
TCGTCGAAAGCAAGCGAAACCAAGATCTTTGAAAGGTCAT
GAAAACCGGTTAAATGCAAATGACGATGGGATGAATATGG
GAAAGAAAGATTGCTCAGAGGAGAGGGGCAAAGAATGGGA
TGAGGAAAGTAACAGACATGGACAAGGGAAAGAAGAAAGT
GCTGAAGAGCCTACAAACCTACCACAATCAGAATCACCGG
TCCAAACAAAGTACTGCCATAGTTCAGCAAACCGCAATGT
TGAGGAAGATGAAAAATTTTGTTTGGGTTTTCCTGAACAT
TCCTCCACTGACCATGAAGATGGATGTGGCCTTGGATTCA
GGGGAGAAACATGCAGAGACCATCAGAGATTCGGTCTGAG
CGGGAAGGTGAACACCCCTTTGCCTGGCAACAGTTCAGTA
CCTCTTGAAATATCACAAACAGATGCAAGCGACGAAAGCC
CAACAAAAAACAAACAGGACTTTAATAATCAGTTTGAGCA
GGCTAGTACGTTGTCCTTGCAACATCTCTCTCTTCTAAAC
GATGTACCAAATTACATGGGGGACCCTGAGAAAAGAAAAC
CTCCAAATTTTTCAGCACAAGATCAGTCAGACATCTCAAT
AGTGGAATGCACACGTATCAACTCACAAATACCCAGTCTA
GCAACCCTGGCTGCTTCTGGCGAAAAGCACGTGGCTGTTT
CTGGAGAAAAGAGAAAGTCTCCATTTGACGGTTGTTTAGG
AATCTCTAAAAAGCTCAAGATTATAAGTAATTATGTTCAC
AACCACGTGGACTCCAGACCATGTCCACAGACTCGACACA
TGGAGAATAAGATCTGCTCCAGTTCTGAGATTCTTACTTT
TCCGTCTGAATTGCACCAGAAAGAGGCTAATGTAATGCTA
GGCCATTCTGTGTTGCTTGAAGCTGCAATCACAGCAGCCG
TTCAGACAGTTCTTCAGTGTAGCTTCTGTCCCACATCGTT
AAAAAACCTTGAAGCTCTTCAAGAGCATGTTCGGCGAACA
CATAACTCTGCTTTAACTGAAAGCAATGTCTTCTTCTGCT
CACAGTGCTTTAGAGGATTCCTTACAAAGGACACGCTAGA
TAATCACATGCAGCAGACCCACTGCAGAAACCAGAGCCCA
AAACTTGATGCTGATCCAGAAGAAATAGCAGAAAGGTCTT
TGCAATTCTGTCCATACTGCAGCCACTTGCCTACATTTAG
CAGTAAACTAAAACTGATGCAGCATATCAAAATGATGCAC
AAGAACACTAACTTGATGAACCTCACAGATGGAAGAAGGA
CAACTGGTTCAACATCACCTCAGTCAATTAAGAGTCCAGC
CAAAAAAGCAGGCCACTGTGCCATACCTTCATCCGACTTC
ATATGTGACCATTGCGGAGCTAAATACACAGATCTGGATC
TGTTTCAGACTCACTTGAGCTCTCACCTGAAAAGTTTGCT
TCCAAAACTTACATGTCAAGAGGGCTTGAGGGATTTCCCA
AACAATGAATCCTTTAAGGAGCACACAGTGTTTCAATTTA
GCAACACATCTACGTTCTACATCTGTGAGAGCTGCGGTAA
GACCTTCACTAGTGTGAAAGACTTACATGGGCACCTACTT
GAGATGCACACTGTTTCATTTTACCGCTGTTCCCTATGCC
AGCAGGTGTTCAGCTCTAAGGTGTCTATTCAGGTTCACTT
GGCCTCTGAACACAGCAACAAGAGAACGACATTCCACTGT
ACGTCCTGCGACTGGGACTTCAAGCAAGAGCACGACTTGC
ACCTGCATGTCAAAGAGAAGCACCTCGACAAACAATGTAA
GGCATACTGTTGCATCTTCTGCACGGAGTCCTTCACTACG
GATGTTGACTTGCAGTGTCATATCACCACACACAGCGACA
AATGCAGTCCCTGCGTCTGTACTAAGACCATATCTCCCCT
CGAGGTGCCCTTACACGAGAAACTCTGTGCCAAGAGCCAG
AGCGTTGAAGGTAACAACGTGACCCCTCCACCTGTCTCTG
AACCAGTTGCCAAGGACGGCGCTGGATTCCTGCCAGCGAA
TAGTGAAATAAGAGACGGTAAGGTGGAATTGCTGTTCAGC
CCTCCCACTGAAACCAAAGGGAAGGCGAGCCTCAGCGATC
CTATGTTTGCCTGTGAAATCTGTGGTGCTTCATACACCAT
GCAGTCCTTGCTCGCCAACCACCAGCTGCGAGATCACCAC
ATCCAGCCTGGGGAGAGTGGCACTCTCAAGCGCAAAGTGG
AGGCGATCCAAGGGAGCCACAAATGCAAAGACTGTTCCAA
GACCTTCTTCACTGAGATGGCTCTGTGGGAGCACGTCCAG
ACTCATCTAGGCCCCACCAAGCACTGCCAATGCCCCATCT
GTGGAGAGCGCTTCCCCTCACTGCTAACTCTGACTGAACA
CAAGGTCACCCACAGCAGGAGCTTGGACACAGGCAACTGC
CGCATCTGCAAGCTTCCTCTTCACAGTGAGGAGGACTTCC
TGGAACACTGTCAGAGGCACCCAGACCTGCACAACTCACT
GACAGGCTTCCGCTGTGTCGTATGCATGCAGACTGTCACC
TCCACTCTTGAACTGAAAATTCATGGAACTTTCCACATGC
AGAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf521-201 Contained in:
[BAC] CH73-164O4 (1)

Genome Resources: Vega_Trans:OTTDART00000044989 (1),  Ensembl_Trans:ENSDART00000123559 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB779295 (1) 469 nt
CITATIONS (2)