Transcript

slc46a3-201

ID
ZDB-TSCRIPT-141209-1416
Name
slc46a3-201
Previous Names
  • slc46a3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043159 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043159|OTTDARG00000031044|ZDB-GENE-100105-2 slc46a3|OTTDARP00000034221 slc46a3-001 LG_ AL928852.7 Danio rerio protein_coding KNOWN, 2250 bp
GGATTTGTAGTCTTGACAAACATACGTAAGGAGGGGAAGT
GTTTCTCTTACAGGATCTACAGTCCCAAACGAGTTCTAGA
AGACAACATGAACATCTCATCGTCTGATCTTTCTGTTGAC
TGTGTCCTCTGACTTCCCGAGTGGATTTGAAGGCAAGCAT
GCTTTAAGAATGGAATTAATTCATAACGTTACACTTTAAT
TACAGTGTAGATCAGAAAGGGGGATGGCTCGTGTGTCTCT
GATTGAACCAGCGGTTGGCCTGTATGCTTTTGCCATGTTT
ATGTTCTACCCTCTGCTACAGCAGTATGTATATCGTCGGC
TGTGGTTTGAATTGAGCGGCTTCATCTATACTTCTGAGAG
TCTCTCTCACTGCTCCAGCAACCACAGCTACATCACCTTA
CACCAGGCTGTTCAGAAGGAGACGTCACTTTTTCTCCTCC
ACAGTGAACTTTGCTTCCTCATTCCCAGTCTCATATCTGC
ATTACTCCTGGTCTCATACAGTGATTACTGTGGCCGTAAA
GTTGCCATTGTTCCTCCTCTGGTGGGTGAAGCTCTGCACG
CCCTGAGCTATGTCTTGGTCAGTAGATTTTCCTTTAGCCT
CAATTACCTGCTCGCTTCCTCCTTCATGTCAGGCCTGATG
GGCGGACCTCCCACTTTGATTGGCGGATGTTTTGCATATG
TCGCTGACCTCTGTGGGGAAGATCTAGAAGGTCAGAAGAC
AGTCCGAATGGCTCGGCTGGACATGATTTTAGGTGTTTTG
ACTGGCTTAGCCTCTCTCTGCACTGGATTCTTCATTAAAG
CCGCTGGTTTCACCTGGCCCTTCCTCACGGCTGTCTTTCT
GCATTTGATAAACCTGCTGTATGTGTTGGTGGTCCTGAAG
GAGTCCTTGGTTCTTCCGAATTCGGCTGTTTCTACATCAA
GCCCTTCAGCTTCTGAAGCTCCTCGACTGCGGCAGACTCA
GGCTCTTACCACTCGACTGCAGGGTGTCTATTTGCTGTTT
GCAGCCTCCAACCGGAGAAGGAACGTAGTACTGTTGCTTA
TGCTGGCTGCTTTTGCCTTTTTCAAGTTAGCCCTGCAGGG
TGGCTGGTCGATCTTCATCTTATATGAGCTGAATACTCCT
CTGTGCTGGAGTGAGGTGTTTGTGGGTTATGGCTCGGCTC
TTTCCACTGCCATCTATCTGGTGAGTTTTGCTGGTGTGGC
GCTGCTGTCCCGATGTCTGCCTGACGCCTACATCATCCTG
CTGGGCCTGATGTCTGTGGCAGCCGGCCTCATCATGGCTG
CCTTCGCAAAGACCACCCTGCTTATGTTCCTGGTGCGGTT
GCCATTGCTGCTGTCCATCATGCCCACTCCTGTCTTACGG
TCCATGATGTCCAAAATAGTGTCTGGATCCGAGCAAGGTG
CCATGTTTGCGTGCGTAGCCTTTGTGGAGATGTTGAGTGT
TGGAGTTTCATTTACGGTGTTCAACAGTATCTATGCAGCA
ACACTCTCCTGGTTTTCTGGGTTCAGTTTCTTGTTGGCTG
CAGGACTCACTGTTATTCCATCTGCCCTTATATGTGTTAT
ACTTTGTCTCCGTCTGGATGTGTATGAGGAATCCATCAAA
CTGACAGAGAGCATGGAAAACCACACAGAAATCTTGGAGA
TACCACAATAATATGGACACTAGAAGAACATTTCCTCTAA
CTTTCTTGCATGACAACAGTGCCCTCTGGTGGGAAGTTAG
AAAACTGAGTTCATTGATGATTTACAAAATGCAATTCAAA
GGTTCTACTGGCACTTTGAGAATAAAACAAATATCTTTTA
ACCCTTGTCTTGAGTTTAACAAATCTCCAAGGACCACAAA
TTTGTCTTTTTTTAGTTACTGAAGAAACTAAACAGCCTCA
ATTTCCCCAAGGGTGCACAAATTAACAGTAATTTATTTAG
TTTGTTTTTGAGTGAACTAACTTAAAATTAGGAACTCTGA
TCCGAGTGTTAACACTTTTTGTTTTCTTTTTTGGGGCCTA
CATGAATGCTACTTCACAGTTTGCTAAAGAACAGATTAAT
AACACTGTCCTTCTTTTTTGTGAAAAAGACCAAAAATATT
TTGTACAAAAATGTGTTTATTTTTATTTATCATTTGTTTC
ATGTAATAGTATGCATGCTTACAAGAGGATATGAAATTTT
GCATTTGGATTTTTACGTTACACATTAGTATATTTCTGAA
TTGTAATATTGGTAATGTATTTTTTAAATAAAGCCATTTG
TAAACCTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations