ZFIN ID: ZDB-TSCRIPT-141209-1327
Transcript Name: si:dkey-204g14.4-001
Previous Name: dkey-204g14.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030053 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030053|OTTDARG00000023129|ZDB-GENE-141212-13 si:dkey-204g14.4|no_translation DKEY-204G14.4-001 LG_ CT978957.10 Danio rerio processed_transcript PUTATIVE, 774 bp
CGCGTTTCTGTGCACACGTGTATCGTCCAGTTGCGTCTCG
CGTATTCTCCGATCTGCATCGCAAACTCTACGCCAACGAG
GGACTTCTTCAAAGCATCAGAGAAACTCGCACGACAAGAG
AAACTCGGATGAACCACTCCCACACACCTAGTCAGACTGG
AAAGATCCGACTGCATCTCTTGACTTCTCGCCTTTATTCT
TCATATTTTGGGTCTGTTTCAGATTTAAACGGGTCTGATG
GAGGAGACACTCCGTCATGTCAAAACAAGAGGGAAAATTG
GCTCACTGAAGGGAAAAGACGAAACATGTTTGACCTGCAC
TCAGTGTGGAAAGAGTCTGAGATGCCAAAAGAGTCTCAGG
AATCACATGATGATCCACACTGGAGAGAAACCGTTCACAT
GTGCTCAGTGCGGGACGAGTTTCAGACATTCATCAAATCA
TAATAAACACATGTTGATCCACACTGGAGAGAAAACACAC
AAATGTGATCAATGCGGCAAAACATTTTTAAGGGCTTTAT
ATCTAAAGAGCCATCTTAGAGTTCACACAAAGGAGAAACC
TTATTCATGTTCATTGTGTGAAAAGAGATTTAGAGATCAG
TCAGATTTAGATACGCATCAGAAGATCCACACTGGTGTGA
GAGAGCATGTGTGCTTTGAGTGTGAGAAGACTTTTATTAG
AGCTGGAGATCTGAAACTGCACCAGAGGATTCACACTGGA
GAGAAACCGTACACATGCGTTCAGTGCGGGACGAGTTTTA
TACGTTCATCACAC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-204g14.4-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030053 (1),  Ensembl_Trans:ENSDART00000160171 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV105251 (1) 845 nt
GenBank:CV487189 (1) 799 nt
GenBank:CK696336 (1) 780 nt
CITATIONS (2)