ZFIN ID: ZDB-TSCRIPT-141209-1253
Transcript Name: fgf4-201
Previous Name: fgf4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019992 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019992|OTTDARG00000016624|ZDB-GENE-001006-1 fgf4|OTTDARP00000016894 fgf4-001 LG_ AL929586.19 Danio rerio protein_coding KNOWN, 3170 bp
TGTGCTCGGAGTGGCGCAGAAGGCTGCTCCGTCATGCACT
AGGTAGTGTGTGATGTAATTTCGCTGCAGATATAAATATC
GTCGGCAAGGGAAAGTATACAGCATGGCTGTGCGTGGCTA
GGATTCACAGTCAAAATTTTCCAACTCTTTTTGACAGCTT
GAACAACAGTCTAAAGTATATTGTCTTGAGAGGAAACCCA
CTGAGCGCGACTTCATGCCGCTCACTTGGGTTGACCGTAG
CTCTGTCCGTGAGTAAGCTGTTTTGTGCGTCTTTTTGGCT
GCCGACTCAAGCATAGAGAAAAACGGTAGCCGGTGTCTTC
AACTCCTTTTAGAAGGATGAGTGTCCAGTCGGCCCTCTTG
CCAATCCTGGTCTTAGGACTAATGACAAGCTCTGTGCGCT
GCGCTCCGCTGCCCGGTGGACACAGCGGCCCCGTAGAGCG
ACGCTGGGAGACCCTCTACTCGCGTTCACTAGCACGAATC
CCCGGGGAAAAAAGAGATATCAGCAGGGACAGTGATTATC
TCACGGGCATCAAAAGACTCCGACGTCTCTACTGCAACGT
TGGCATTGGGTTTCATCTTCAAGTATTACCGGGTGGTAAA
ATCACCGGCGTACACAACGAAAACCGCTACAGTCTTCTTG
AGATATCTCCGGTGGAGAGGGGAGTTGTGACACTGTTTGG
CGTGCGGAGCGGGCTATTCGTGGCCATGAACAGCAAAGGG
AAGCTTTACGGATCTGAGCAGTTCACAAACGAATGCAAAT
TCAGAGAAAAGCTCCTCGCAAATAATTACAATGCGTACGA
ATCGCTGGCACATCCTGGGATGTACATCGGACTAAGTAAG
GCTGGCAAAACAAAGAAAGGAAACCGAGTATCAACATCCA
TGACGATGACACATTTCTTGCCTAGAATTTGAGCTCATTT
TGGACGGGCGTAAGGCGGAGGAACGACGATGCACTTTCTA
CCAGAAGTTAAATGTGAGGTTAAGTGTATCGTGTCATGAT
GTATGTATATATTAGACTATTTATAACTGTTGGTTTTATA
TTTCATCACACCGTCCTCTTTGCGAGGTGGAAGACAACAA
TTAATTTATTTGTTATTTGTTAATTTATCCTCATTGCTGC
TACCACGTGTTCATATACAAGTGAAATTCCTACAAATGTA
AACATATCTTTTTTTGCACTGTTTGTGTTGTTCTAATGCG
TTTTGGGGAGGTAGTCAAAAATACGCCATATTTAATTTGA
GTTTTTTAGGACAAACAGTATCCAAAAGTGTTCAAAAGAC
GTATTTTAAAAGTCTGCAATCAACTGACAACAAGAAACGC
GATTCCTCGCGTCCTAATTTTTAACCGCGAAAAATTAAAT
ATGGCGGCAACGCTGACTACGGTCTATTTGTCCTTCGTCG
GAAATAATATGTAAGTCTTAGGTCAAGCCTCCAATCGTTA
AGGTGTATCAACCCCCATAGTATTAGCACTGGAGCAATTG
TCCAATGTCTGGGCTCCTTTGTGCGGAGCTCGGATCTAAC
TGAAGCAGTATCGGCTTACTCTAGCTTACTGAAGTTCTAC
CCCTTCAAATCTGTTTTTAGCTCTGCCGGGGGGTTGAACT
TTGAACTTATCTGCAGTCAATCTTTGTCACATCTCTAAGG
CTCTAGATCAAGAGAAGTAGCTTCTTTAACATAGAGACAT
GAATTTTTAAAAATCCAAAGGGATTGCCATGCATATACCG
TATACCCTGAGCCCTTTGGACAGACAATGTCAAGTTCAAG
TCAAGTTTCTGCTGTGGATTTTGGAAGATATGAAGATCAG
TATTTTTATGATGGTAACACAAAAAAAAAAGAAATGACAG
TGTTGTGTATAAGAGTTAGCGTAAATACAAATGTCACAAC
TTCCACAGTGAGTTACAAGAAGGCGTTTACCCACTTTGTT
TGTCGTTTTCTACCTCATGCAGTTTCCAACTGACATTTCC
TACTTTGAAAATCAGCTGACACCGAATGTTTAGCTCTAAG
TTGCTCTTCTGAGGCTCCTGCCACTCTGAAGTTCTGGCGG
CCATTGCGTCCTAGTTGCGCCTTGTCACGTTTGAGCTATC
TTTACCCTGTGATTTACTTTTAGAAAGGATAATCATGTTG
GAAATATTTGCAGACAGCTGTTAGACTACACTATATGCTC
AACAAGTAACTCTATATTTTTCTTAACATATTTTGTAAAT
ATGGTGCAAAACTCAGAAGCTGCTTTAAACTTATATGGCG
TTAGATATATTAATAGTAAGATATGATACACTCATGCAGG
GATTAACAGGTTTTCCATCTTATAAACATATATTTGAGCA
ATATTATCTTTAAAAAGCATTCCTTACTGTCATCGTCAGG
TACATTTCATTGAGAGAATCTAAAAATGTACCTGTACTTG
AGTGTAATTCTGAACTGAAAATGAACAGATAGTCTTTTGG
GGTTCAAGAAAACCATTTAGGAATAAAAAAAAAGAAACTG
AAGCTAAACTGACCGGTTGACCTCAAAAGCATCAACACAT
TCGTATAGTTTCATTTACTGTAATTTTAACTGTTACATGT
CCAAATTTGTTTCTTAATATGCCCTGCCTGGATGTGCACA
TCAATTAGTTTCACTTGATGACTCTAAGCTACCTAAGCTA
ATGCTGGAGGAGGGAAGGGTTGTCTGTCTTTCTCTTTTCC
ACATCTGTGCCAAACCTCTTTCCAAATGGACGTGATTTGC
ATCAGTGTGGATGTTGTTTACAATAGACCCAATGGCCACT
GAAGGCAAATTGCTCGTCTGACCCTCATCACAAATCACTG
GACTTGATTTGTTTAACCAAAAAAATGCAATATCAACAGG
CATGACCTAGTAGCCTGAGATTAGTGGAAACAGCCACTCC
AACACAACAATGTTCCAAATTTTGCCATTGTCTGGATGTG
CTTATGAACAGGGATGTATGCTGTGTATTGAAATCAATTT
TCTCTGTCAATTCCCATAAGGTTTATCGATAGCAGAGCTC
TAAAGTAAATGGGCTAATGTCTGAGTCCTGTCGTAGTGCG
CTCTGAATCCTGTTTTACCAAATATTGTCTGTAGTTTTAT
ACAGGTCTTGTTAAATATTGTGATGTATGTGCTGTGCACA
TGATGATACCCTAACTTAAATGGAAGTTAATAAATATGTA
AATCATGCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgf4-201 Contained in:
OTHER fgf4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019992 (1)
  • Ensembl_Trans:ENSDART00000158898 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA470801 (1) 927bp
    GenBank:AF283555 (1) 576bp
    GenBank:AI957973 (1) 485bp
    CITATIONS (2)