Transcript

si:dkeyp-94g1.1-201

ID
ZDB-TSCRIPT-141209-122
Name
si:dkeyp-94g1.1-201
Previous Names
  • dkeyp-94g1.1-001
  • si:dkeyp-94g1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032193 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032193|OTTDARG00000024584|ZDB-GENE-030131-7910 si:dkeyp-94g1.1|OTTDARP00000026122 DKEYP-94G1.1-001 LG_ BX511304.5 Danio rerio protein_coding NOVEL, 1915 bp
AATTACAATTGAGCTCCAGCAGACGCCTCTTGTAAAAAAA
AAAAAAAAAAAAGTGCAGAGAGGATCTGGAGTCATGCATG
AGAGTCTGTTTATGCTGCTGCTGCTGTCAGGGCTTTTGAG
GATGAATTCTGAGCTTTATCGTGATTACTACTTTATAAAT
ATAAGAATGTCATGGCCAGAGGCTCAAAGTTACTGCAGAG
CGAAGTACACTGATCTGGCTACGGCAGAGAGCACGGATGA
TGTAAACAGGCTGTTAAATTCAGTGGGTGCTCAATACAAT
GGATCGGTGTGGATTGGACTGAAGAGAGGGACACAGAAAC
GTTGGGGCTGGTCTTATGGAGATAACACAATCGCACAGTA
CGCTGCTTGGAGCAATGGAGAACCGTCGAGTACAAATGAA
TGTGGCTTCTTGGCTTACGGAAACTGGCGCACTTACAATT
GCTCTGATCTGATTTACTTTGCATGCTACAATGGCACTGG
ATACACCATGTTAACTATGTGGATGAATTGGACCGATGCT
CAAAGATACTGCAGAAAGCATTACATAGACCTACCCACCA
TCCACAACTCCACAGAACTGGCGCAGATAAACAGTGCTGT
TTCCTACAATGCGTGGCTCTGGATTGGCCTGTTCAAGGAC
TCCTGGGAATGGTCTGACAAATGGGGCTGGTTCTTTAGAT
ACTGGGCAGTAGGTCAACCATCCCCGAGTGCAGGATCTAG
TGACTGTGTCGGCATGTCAACGACTAATTTTGGCAAATGG
GCTTCATACAGCTGTGGCCTACAGCAGCCTTTTATCTGCT
ATGGAGGGACAAAGTTTCCTTACATCTACCAGTATGTGAA
TAAAAGCATGACGTGGCCAGATGCTCAGAGTTACTGCAGG
GCGAGATTCACTGATCTGGCTACTGTAGACACCATGGATG
ATGTGAATCGTCTGGTAAATATAGTGGATCCTGGATTTAG
TGGTTCAGTGTGGATAGGTCTCCAAAATGGAGGACAAAAC
CGCTGGATCTGGTCTTTGGGCAACGGCGTACTGTCCACCT
ACAGTTTCTGGAATCCAGGAGAACCGAGTGGAGATGGGGA
TTGTGGGAGCAGTACTTATGGAAACTGGTCTGATGAGAGC
TGCAGCACTGTTCTCCCATTTTTATGTTTCGATGATCACA
CTGGATTTGCTATTATTAATACTGCTATGACATGGAGAGA
TGCCCAGAGCTACTGCAGACATTACCACACTGATCTGGCG
ACGATCGACAGTGTAGATCAGCAGCATATGATCAGTACTC
AATCAACGCTCTGGATCGGCCTTTTCCTCGATTCTTGGGG
ATGGTCTGATCAGGATATTCTCAGTTTCAGATACTGGGCT
CCTGATCAACCACCCCTCAGTTCAGTATCTGGTGACTGTG
CTGGCCTGTCAACAGCTGATTTTGGGCAATGGGCTCAATA
CAGCTGCAATTTACAGCAGAATTTTATCTGCTACGGAGAT
GACAGCTTAATTAATAAGCAGATTGTTCATATAAAATTGT
CCTGTAAAGATAAATGCACACCGAATGACCCCACACTACA
GACCGCCTTTCTAAATAAGATAAATGAGAAGCTGAGGAGC
TTGGGACTGGAAAGAAAGAGCAAAATAAGCTGGAAACAGA
GTGAAGATAAAGAGGTGTTTCATGAGGAGACTTACCCGCC
AACTAATTATTGAACGTAAAGGCCAGCATTCATCTGTGTA
CCTCACTGACTTTGAAACCGATTTAAAGATTAAAAGTTGA
AATATTAACTACATATAGGAGATAGAAAGTTGTATCAATT
AAATAAGAACAAATTGAACTACAAATAGTTTTATTTCTAA
GATTGAAACTCTCTTAAATGTTCATTTTTGTAACCTAAAA
TAACTACTAAAAAGGTCAATAAAATCCAAATGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations