ZFIN ID: ZDB-TSCRIPT-141209-113
Transcript Name: dph5-201
Previous Name: dph5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030533 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030533|OTTDARG00000023442|ZDB-GENE-041114-85 dph5|OTTDARP00000024875 dph5-001 LG_ BX908733.16 Danio rerio protein_coding KNOWN, 1505 bp
TACGGCAGCCGGTTGTCAGTTGTTCCATGTGGTACCATGC
GAGTTCTGCACAACAGCAGAAGTTGCATGACATTCGTTGA
CAGACAGCTTTTTCACATCTCTCCAAAGCGCTTGTAAATG
TGTTATTTAATGATTTAGTCTTTTAGCGACGTGTACCCGT
GCATTTTGGTGTCATCTGCACTTTAGAGATGTTATATTTG
GTCGGTCTCGGGCTGGGCGATGCTAAAGACATCACTGTCA
AAGGGCTGGAGATCATCCGGAAGTGCAGTCGTGTTTATCT
GGAGGCTTACACATCCATACTGACTGTCGGGAAGGATGCT
TTGGAGGAGTATTATGGACGTGAGTTGCTCCTGGCAGACA
GAGATATGGTGGAGCAAGAGGCGGATGAGATCCTGAAAGG
AGCAGATGTCTGTGATGTGGCTTTTCTGGTAGTTGGTGAT
CCTTTCGGAGCCACGACCCACAGTGACCTGGTTTTGCGAG
CACTGAATGCTGGGATACAGTACCGCGTTATTCACAATGC
CTCCATCATGAATGCAGTGGGCTGCTGTGGATTGCAGCTG
TACAACTTTGGTGAGACGGTGTCTATTGTGTTTTGGACGG
ACACGTGGAGACCCGAGAGCTTCTATGATAAGATCAAGAA
GAACAGGGATATGGGCCTGCACACGCTGTGCCTGCTGGAT
ATCAAAGTCAAAGAGCAGTCCATGGAGAATTTAATGAGGG
GTCGGAAGATTTACGAGCCTCCCAGGTATATGACTGTCGC
TCAGGCAGCTGAGCAGCTCTTAGAGATACTACAGAACCGA
CGGGATCGTGGCGAGGAACTGGCAATGACAGAAGACACTG
TGTGTGTTGGTCTGGCTCGCGTTGGAGCTGAGGATCAGAC
CATCCGTTCTGGAACATTGCGTGAGTTGGCATCTTGTGAC
CTGGAAGGACCATTGCACTCGCTGATCATTAGTGGACATC
TTCACCCTCTGGAGGTCGATATGCTGAAACTCTTCAGCAG
TCCTGAGGGATTGAAGAGCTTGAAGATGACCGATAGTTCC
ACATACGTTTCCTGATGTCCAAGAAACTAGTGGTCCTCAA
GGGAAAGCACACAGAATCCGGTCCATGCGAGAGTTGCCGA
ACTGTCAGGAGTAGGTACAAATGATATAATTGTTCTTCCA
GATTAAATCCGAACACTTGATTAGGTGATTCCAGAGTGGG
ATGCTTACTTTGATGTGTGGCAGTCATGTACATTGACTTA
AAGAAATGATGGACTTATAATGGAGGAAATGGAAAAGGTT
ATTGTGGGGCAGCTCATCTGGGTTGCATTAGTGCCTCTGA
TGCTTTCTTTTTTCAAAATGGGCATAATGTTTCTGTAGCA
AGAGGCTCTCATAATGGCCGTTTCTCAGTAAGAATGTATA
CAAGATGGACACCGAGATACTTTCAAGCATGTTACCCACC
CATGTCATAATGGATGAGGATCGATTTTTGTACAATAAAG
ATGCTCATTTTGTGGCCACTGTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dph5-201 Contained in:
[BAC] CH211-190N7 (1)

Genome Resources: Vega_Trans:OTTDART00000030533 (1),  Ensembl_Trans:ENSDART00000165216 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC085447 (1) 1535 bp
GenBank:DV595455 (1) 740 bp
CITATIONS (2)