Transcript

dph5-201

ID
ZDB-TSCRIPT-141209-113
Name
dph5-201
Previous Names
  • dph5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030533 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030533|OTTDARG00000023442|ZDB-GENE-041114-85 dph5|OTTDARP00000024875 dph5-001 LG_ BX908733.16 Danio rerio protein_coding KNOWN, 1505 bp
TACGGCAGCCGGTTGTCAGTTGTTCCATGTGGTACCATGC
GAGTTCTGCACAACAGCAGAAGTTGCATGACATTCGTTGA
CAGACAGCTTTTTCACATCTCTCCAAAGCGCTTGTAAATG
TGTTATTTAATGATTTAGTCTTTTAGCGACGTGTACCCGT
GCATTTTGGTGTCATCTGCACTTTAGAGATGTTATATTTG
GTCGGTCTCGGGCTGGGCGATGCTAAAGACATCACTGTCA
AAGGGCTGGAGATCATCCGGAAGTGCAGTCGTGTTTATCT
GGAGGCTTACACATCCATACTGACTGTCGGGAAGGATGCT
TTGGAGGAGTATTATGGACGTGAGTTGCTCCTGGCAGACA
GAGATATGGTGGAGCAAGAGGCGGATGAGATCCTGAAAGG
AGCAGATGTCTGTGATGTGGCTTTTCTGGTAGTTGGTGAT
CCTTTCGGAGCCACGACCCACAGTGACCTGGTTTTGCGAG
CACTGAATGCTGGGATACAGTACCGCGTTATTCACAATGC
CTCCATCATGAATGCAGTGGGCTGCTGTGGATTGCAGCTG
TACAACTTTGGTGAGACGGTGTCTATTGTGTTTTGGACGG
ACACGTGGAGACCCGAGAGCTTCTATGATAAGATCAAGAA
GAACAGGGATATGGGCCTGCACACGCTGTGCCTGCTGGAT
ATCAAAGTCAAAGAGCAGTCCATGGAGAATTTAATGAGGG
GTCGGAAGATTTACGAGCCTCCCAGGTATATGACTGTCGC
TCAGGCAGCTGAGCAGCTCTTAGAGATACTACAGAACCGA
CGGGATCGTGGCGAGGAACTGGCAATGACAGAAGACACTG
TGTGTGTTGGTCTGGCTCGCGTTGGAGCTGAGGATCAGAC
CATCCGTTCTGGAACATTGCGTGAGTTGGCATCTTGTGAC
CTGGAAGGACCATTGCACTCGCTGATCATTAGTGGACATC
TTCACCCTCTGGAGGTCGATATGCTGAAACTCTTCAGCAG
TCCTGAGGGATTGAAGAGCTTGAAGATGACCGATAGTTCC
ACATACGTTTCCTGATGTCCAAGAAACTAGTGGTCCTCAA
GGGAAAGCACACAGAATCCGGTCCATGCGAGAGTTGCCGA
ACTGTCAGGAGTAGGTACAAATGATATAATTGTTCTTCCA
GATTAAATCCGAACACTTGATTAGGTGATTCCAGAGTGGG
ATGCTTACTTTGATGTGTGGCAGTCATGTACATTGACTTA
AAGAAATGATGGACTTATAATGGAGGAAATGGAAAAGGTT
ATTGTGGGGCAGCTCATCTGGGTTGCATTAGTGCCTCTGA
TGCTTTCTTTTTTCAAAATGGGCATAATGTTTCTGTAGCA
AGAGGCTCTCATAATGGCCGTTTCTCAGTAAGAATGTATA
CAAGATGGACACCGAGATACTTTCAAGCATGTTACCCACC
CATGTCATAATGGATGAGGATCGATTTTTGTACAATAAAG
ATGCTCATTTTGTGGCCACTGTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations