ZFIN ID: ZDB-TSCRIPT-141209-1112
Transcript Name: zcchc4-201
Previous Name: zcchc4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061918 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061918|OTTDARG00000042846|ZDB-GENE-080204-65 zcchc4|OTTDARP00000048425 zcchc4-001 LG_ CR848021.10 Danio rerio protein_coding KNOWN, 1887 bp
GCGTGGTTTGCGCTGTTATGGCAGCCTCCTGTCATGCATG
TGAGTGTTATTTTGATTCTCATTTGAAATAGTTCTCGCAA
AAAATGAGCAAAACAGCGGATGATGTCGTGGAAAGCGGCG
GAATTGAAGTCATTGTTCAAAAAGAAAGTGACAAAACTGC
ACCACGATGTCCTCATGGACCCGCTCTGCTTTTCGAGAAA
ACTGGCCACGGAGAAGAAGAAAAAGGCAGGAGGTTTTACG
CGTGCTCTGCTTGTCGGGACAGAAAAGACTGCAACTTTTT
TCAGTGGGCAGACGAGAAGATATCAGAAGCAAGGATGCTG
GCCAGAGAGGAACAGAACCGCTCTAAAAAGCCTCTTTTCA
CTCATCAACAATACTACTCCAGATTTCTCGAGTTTGCTTC
TCTCCCACTGGAGCAGAGAAGGTTTTGTGTGGACTGCCAG
CTGTTGATCCTCCCTGGAGAATGGATGAATCATACTAAGC
ATAGGGCACTTTCTGAGGACGTCACAGTTCAGCGGCTGAA
GAAGCCCAGTTTACTGCTGAGTCCTCTGGACAACAAGAAG
AGCAATGCACAGTATCTGTTTGCAGAGCGGAGCTGTCATT
TCCTCTTGGACACACTCAGTACATTAGGTTTCCGGAAATT
GCTCTGCGTAGGAACACCACGCTTACATGAGGTGGTTAAG
ATGCGGAATCTGGAAGACAAGAGTCCTGTCATAAGGAGTT
TATTGCTGGACATTGATTACAGGTACTGCCAGTTTTATGG
ACAGGATGAGTTCTGTCGCTATAATATGTTTAACCATCAC
TTCTTTGATGATGAGGAAGCGGTCAAGTTTTTTCAAGGCT
TTCTGCAAGAGGAAGGAGGAGAGAAGTTAGTCATGATAAC
AGACCCGCCATTTGGAGGCCTGGTGAAGCCACTAGCCAAC
AGTTTCTCTCAGATATCAATGACCTGGAAAAATCTGAATA
AAGTGAGTGATGCTTCAGCTGAGATGCCAATGATCTGGAT
TTTCCCGTACTTCTTCGAGTCCCGTATCCTTGAGTGTTTC
CCCTCGTTCTCTATGCTGGATTACCAGGTCGATTATGATA
ACCACCCTCTGTATAAACATGGAAAGACGGGCCGTAAACA
ATCACCTGTTCGACTTTTCACCAACCTGAGCCCCAAAGAT
ATCATTCTACCAGAGGCTGAAGGTTACAGATTTTGCAGTG
TTTGTGAGAGGTATGTGTCAGCAGCAAACAAACACTGCCC
TAAGTGTGACATGTGCCCATCAAAGGATGGACGAGAATGG
AGACACTGTGATGAATGTGGACGGTGTGTGAAGCCCTCGT
GGCGTCACTGTTCCTCATGTGGTCGCTGTGCTCTTCCTGA
TCACCCCTGTGGTCAAAGGCAAACCGGCTGTTTTAACTGC
GGCAGCCAAAAACACAAACTCAGAGCCTGTCCTAAGAAAC
GAATGCTTGTGTCGGGTGACCGCGGAGCTCCAGGCCTGTC
GAAACACAAAGCAGGCAAATCCAGAGCTAAGAACAAGCAG
AAAAGAAGAGCTACTTAATCTTACACGCAGTGCATCATGG
GAACAGTGGTTTTGTGGCTGCTGAAAATACATCATAAAAG
TGTGAACCAGTAAGCTGGTGTTAAACCTGACTGTATAGCA
GAAGGCTGTTATGGAATTACCGCCATAGTTGTTTTTTTGC
CATCTTGGTTATGCGTTCATCACAAAGATTATTATACAGT
AATACCTTCTCAGTACTAATGACAGGCTGTGTGAACAAAC
CTCGCGAACGGCCTGGTGTAACACTTCAAAGATGCTTTTT
TTTCAGAAGCCATCTGTGGATAAATTTGACATTATATTCT
TAAAAAATGCAAATAGTATTTTCTAATAAAATTTCACCTG
AATATTG

zcchc4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zcchc4-201 1887
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zcchc4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061918 (1),  Ensembl_Trans:ENSDART00000164888 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154611 (1) 1918 nt
GenBank:BC171462 (1) 1767 nt
CITATIONS (2)