Transcript

si:ch211-59o9.10-201

ID
ZDB-TSCRIPT-131113-990
Name
si:ch211-59o9.10-201
Previous Names
  • ch211-59o9.10-001
  • si:ch211-59o9.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056566 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056566|OTTDARG00000039396|ZDB-GENE-101206-1 si:ch211-59o9.10|OTTDARP00000044364 CH211-59O9.10-001 LG_ CR385081.7 Danio rerio protein_coding PUTATIVE, 1900 bp
AATTGATCAGTGTGCCGGAAGTGTCGTAACCGGAAGAAAG
CAAGAATGACTCCATGGCGGCGTTTTCCATTGTGACTTCG
CTGTTAGCTGAAAAGGTTTTAAGGCGATGATTTGTGCTTT
TCGTTGAGGGATGTTTTGTAATGGTGACTCGCCAGCTCAT
GGTCTGTCAGCTTTAGCCAAAGTATAAACACATTACGCTG
TATTTGAGAAGAGCAGTCATGGACGAGAGACAGGACAGCA
GCAGTGATGACCCCCTTTACAGTCCCCGGATGGAGGCTGA
CCCTCTGGACTCGCTCAACAACGCCTGTTTACTGAATGAC
AGCGACTACCTGTTTGAAGAGCCTGGACTTTCTCACGATT
TCTCCAGCACTTGTGTTCCTGAGACTCCTAGCCCTTTGAT
TCATAGAAGAAAACGACATTCCCAAAAGGACGAGGACAAA
ACTGTGGCAACGTCATCCTGTTCTTATGGAAGAAAGTGGG
AGAGACAGGATCTTATCCCAGGATACCTCAACACCACTCC
AAGCTCACAGAGATTAATGAAACGGCGTAAGCTGGAAAAC
TTAAACACTACTCATTCCACTGTCACCCCTCAAACAAACG
GCTTTGTTTCGGCCTCTTCTCTGTTACCCACTGATTTCAC
ATGGCTGGAGTCTCCACGTCCATTAGCCTCCTCTGCATCT
TCCAAACCCTCCTCCTCAGCAGGATCTGCCACATGTGCAC
TGGATCAAACTGCAGATCTGACATCTTTAAATGAGCAGCT
AGAGACGGGTCGTGCTTCTATGCAAAAGATAATCAACAGC
AGGGAACAGAGACGCAAAAAGACCAGAACTAAAGCCTCTA
AAAGTTCATCCGCACACTCGACTGCACCCACCATAGAGGA
TGAAGCTTTACTGCTGGATTCAGCTAAGCGAATGCATGGA
CCAGCAAGTTCGCCGTCTTTCCTGATACCAGATGATGTCG
TCATCATAGAGGATGATGCTGCTGATGATGTCATGGTGGT
TCGCTCTGTTCAGATGGCTGAGGATGAAGCTTACGCCAGA
AGCCTACAGGAACAGTTTGACATGGAGGAGCGAATCGAGC
AGCAGCAGAGACAGTCCAGCATAAACAACCACAACCATAA
CCATGTGGTTGACTCATATGTGGGTTTGGGCTGGATCCCT
CCGTGGGCCTCAATGATCAGCTCTTCATCTTTCACACACA
CCCCCTCCGAGCTGTCAGAGCTGCAGCAAGTCATCTTTGG
AGAGCAGCCGCACAGACAACAGGGCCGACGTCAAACAGGC
CGAACTCGAGCTTCCCGTCGCAGACCTGCTGCTCACCTGC
AGATGGACTTGTTTAATGACAGCCAGGGAAATAATTATGA
GGCTCTGTTAGCGTTTGAGGAGCAGCAGGGTGCTGTAATG
GCCAAAAACACTCTGAGCAAGGCTGAGATTGAGCGGCTGC
CCATCAAAACATACGATCCCACACACAGCGCAGGAAAGAC
AGACTGCCAGATCTGTTTCAGCGAGTATAAAGCGGGTGAA
CGGCTCCGGATGCTGCCATGTCTCCATGATTACCACGTCA
AGTGCATCGACCGCTGGTTAAAGGAAAACGCCACTTGTCC
GATCTGCAGAGCAGATGTATCTGAGTCCGGTGGTTTTTCT
TGAGCGTTCAGTTTCAAGACTCAATATCTACCTCACAGTT
GGTCGTGTTTGTCTTTTAAACAGTCTTAATTTAAGTGTTA
TCTAGCGCTTTTTAAATGTCATATCGTCCCATTTACCAGC
GTAAACCACTGCCAAGTAAACCATTATGAATATATTTCCT
TTGAAAACAGACAGACGCTATCATAGCAGTGGCCACAAGC
ACTGATAGCAATAGTGCAACTTGCATTTGTTTTGACTTTG
AAATAAAAAAAATCCCTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations