Transcript

si:dkey-34d22.5-201

ID
ZDB-TSCRIPT-131113-99
Name
si:dkey-34d22.5-201
Previous Names
  • dkey-34d22.5-001
  • si:dkey-34d22.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047746 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047746|OTTDARG00000033871|ZDB-GENE-131121-578 si:dkey-34d22.5|OTTDARP00000037485 DKEY-34D22.5-001 LG_ CR936484.5 Danio rerio protein_coding PUTATIVE, 693 bp
ACACAAATACTTCTCTCTTACATCATCTGAATCTGTAAGT
TCACATTTCGAAGACTCCTGGAGCAGAAACACCCTTCCTC
TATGGTCAAAAAGTGGAAGTTAGTCGATTAGCAGTCATGA
ACCGCACTGATTGTCAGTACCGTTTTAAACTGATCATGAT
AGGTGGAGATTGTGTTGGAAAGTCATGCATGCTGCAGCGC
TACACAAGAGGCCAGTTTCCAGAAAGTGTAAATGTGACCA
TTGGAATGAGCTTCCGCAATCACATCCTAGAGGTGGAGCC
CGGGGTGAGAGTGGCTCTGGACATTTATGATACAGCCGGT
CATGAATCCTTTTGGCAGGTTATCTGCTGTTGCTTCCCTC
AGTCTGCCGGATGTCTGCTGGTGTTTGATCTGGGCGATAA
CAAATCTTTCAGTTACATCAAGCATCGATACACAGAGGTG
TGCAAGGCTGTCCGTCCATACAGTGTGCGGTTTTTGCTGG
TGGGACACAAGTGTGACAGAGAAGAGCGAGATGTGAGTCA
AGAAGAAGTGGACGAGTTCGCAAGTAAAGTTGAAGCTCTG
TACATCGAGGCCTCTGCTAAAACAGGTCACAATGTGGCAG
AAGCTTTTGAGCTGTTAACCCGCCACATTTATCAGGGCTT
AATTAATGGAGAAGTGCATTTGCATGAAAGCTGGGGAAAG
ATTGAGAACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations